Download presentation
Presentation is loading. Please wait.
Published byDomenic Stone Modified over 9 years ago
1
Our Test Organism Drosophila simulans
2
Trait of Interest Red vs. White
3
What did we do in lab 1? Vial of 5 white-eyed females Vial of 6 males, 5 white-eyed – With ONE red-eyed male mixed in – What is p(red-eye allele)? 1/11 What did we say about the fitness of the red- eyed mutant? —Sensory perception —Should be more fit because has better vision — White eyes = reduced mate tracking
4
What should we expect to see? More or less red-eyed flies? So we have an adaptive allele (red-eyed mutation)… – Should increase in frequency.. What is this called? Selective sweep – What about polymorphisms located near it? Hitchhiking How can we tell if a sweep and hitchhiking has happened?
5
Genotype the flies near that gene! Need to first get DNA from the flies (DNA Isolation) – Squish flies to release all their DNA Need to look at polymorphisms near that gene – Polymerase Chain Reaction Amplify the DNA of interest enough so we can look at it on a gel Ahhh! Help meeeeeee
6
Drosophila chromosome Red / White eye color gene “Near” “Far” 22 million bases of DNA What are we going to look at? Two markers on X-chromosome o One close to the gene for white eyes o One far from the gene for white eyes Why are we going to look at 2 markers ? 22 million bases of DNA
7
Polymorphisms Red: gene mutated to give flies red-eyes Blue: indel polymorphism – What is an indel polymorphism? – NEAR marker Yellow: indel polymorphism – FAR marker Recombination Hotspot!
8
Who is linked to the red gene? – Blue or yellow? Say that 1 red-eyed male in the first lab had: – Insertion at the near marker (blue) – Deletion at the far marker (yellow) All white-eyed individuals had: – Deletion at the near marker (blue) – Insertion at the far marker (yellow) What will our flies today look like at each marker? Recombination Hotspot!
9
Hypothesis This is called genetic hitchhiking As chromosomes are passed down over generations, they sometimes “trade pieces” with other chromosomes... (recombination) More likely to keep the same close neighbor gene variants than far away neighbors. If natural selection makes one variant spread quickly, its close neighbor variants may also spread.
10
Selective Sweep (positive directional selection) Advantageous mutation
11
Selective Sweep/Hitchhiking Before sweepAfter sweep This is one chromosome from 12 different people. The different colors represent different alleles for that gene. What happened?
12
Selective Sweep/Hitchhiking If a mutation is advantageous it will likely increase in frequency Why? What will happen to genes/traits that are closely linked to the advantageous mutation? What will happen to genes/traits that are not closely linked to the advantageous mutation?
13
Variation at 3 loci 2 variants at the eye color gene – Red & White alleles 2 variants at the Near marker – High and Low – The red-eyed male from Day 1 has the high allele at Near – The white eyed flies had both variants 2 variants at the Far marker – High and Low – The red-eyed male from Day 1 has the low allele at Far – The white eyed flies had both variants
14
Sequence differences (aka variation) between alleles Usually base pair repeats, insertions, or deletions Used for between & within-species comparisons How are we going to observe & measure genetic variation? - Microsatellite Markers -
15
“Genetic markers” Reference point in the genome with 2+ alleles A sequence: AACATGGTGACGGCTAGCA a sequence: AACATGGTGAGAGAGACGGCTAGCA High allele Low allele
16
How to tell males from females Males have black abdomens Look close at the tip of the male abdomen and you will see his junk Females have rounded abdomens FemaleMale
17
Red male Red female White male White female Sexing your flies: males have a “black butt”, females have large white abdomen
18
Sexing FemaleMale
19
A note about contamination DO NOT CONTAMINATE YOUR DNA ISOLATIONS! – Change tips in between EACH fly squish! – Just because you can’t see the DNA on the tip, doesn’t mean it’s not there!
Similar presentations
© 2024 SlidePlayer.com. Inc.
All rights reserved.