1. BIOINFORMATICS
Ency Lee

2. What is Bioinformatics?
Bioinformatics is a fast-field within the biological sciences that was developed because of the need to handle large amounts of genetic and biochemical data.
Bioinformatics includes the concept of the flow of the nucleotide sequence – DNA, and its translation into molecules of life – proteins.
Molecular biology provides the basis for investigating the genotype by means of bioinformatics.
Bioinformatics is the use of computers to handle biological information.
Bioinformatics =
Biology + Computer Science

3. Purpose of bioinformatics
Improve content and utility of databases.
Develop better tools for data generation, capture, and annotation.
Develop and improve tools and databases for comprehensive functional studies.
Develop and improve tools for representing and analyzing sequence similarity and variation.
Create mechanisms to support effective approaches for producing robust, exportable software that can be widely shared.

4. Outline of Bioinformatics

5. Sequence Analysis
All of the proteins are made up of the same basic building blocks, called amino acids.
When you know a DNA(deoxyribonucleic acid) sequence, you can translate it into the corresponding protein sequence by using the genetic code which is the very same way the cell itself generates a protein sequence.
Cytosine
For example…
TCAACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACGGTACCATAAATAC
Adenine
Guanine
Thymine

6. Tools for Sequence Analysis
PubMed on the NCBI Website
This site will be a source for data and analysis of DNA sequences, protein sequences and a variety of other data.
The site is extremely organized and it allows many different kinds of studies to be performed with the data that it provides.

10. 2. BLAST (Basic Local Alignment Search Tool) www. ncbi. nlm. nih
2. BLAST (Basic Local Alignment Search Tool)
This tool can be used for comparison of different sequences that you would find in the database search.
This can be used to compare proteins and genes depending on your goals.
BLAST is based on computer algorithm system which converts biological algorithm system into Alphabet letters.

11. BLAST OUTLINE

12. 3. ClustalW www.expasy.org/sprot FASTA by European Bioinformatics Institutions

13. Genome analysis
It can determine locations of genes on chromosomes and give information on heritability and linkage to other genes.
Bioinformatics tools and databases are gradually becoming an integrated system that reflects the complexity of organisms. With genome projects of small organisms being completed one by one, an understanding of the differences of genomes from the tree urkingdoms (eubacteria, archaea, and eukaryotes) and the relationship of genome organization to the form and function of an organism may be clarified.