1. Xuhua Xia xxia@uottawa.ca http://dambe.bio.uottawa.ca
Mutation
Xuhua Xia

2. Mutation - any detectable change in DNA sequence
eg. errors in DNA replication/repair
inherited ones of interest in evolutionary studies
Deleterious
- will be selected against and lost (purifying selection)
Advantageous
will be fixed in population by natural selection
- rare occurrence
Neutral
will have not effect on phenotype
- may be fixed in population by genetic drift
Xuhua Xia

3. Type of Mutations 1. Point mutations Transition = purine to purine
or pyrimidine to pyrimidine
Transversion
= purine to pyrimidine
How many possible transitions? transversions?
p.38 “In animal nuclear DNA, ~ 60-70% of all point mutations
are TRANSITIONS, whereas if random expect 33%”
Xuhua Xia

4. Types of mutations Missense mutation - different aa specified by codon
Nonsense mutation
- change from sense codon to stop codon
Non-synonymous
- amino acid altered
Synonymous
- “silent” change
2. Insertions or deletions (“indels”)
- frameshift mutations within coding sequences
Fig. 1.12
Xuhua Xia

5. Spontaneous Point Mutation Rates
G – genome size µb – mutation rate per site per generation µg – genomic mutation rate per generation
Table 4 in Drake et al. 1998, Genetics
Xuhua Xia

6. Slippage and Short Indels
Short insertions or deletions
(short “indels”)
eg. if slippage during DNA replication
rapid evolution change in copy number
of short tandem repeats
microsatellites
Fig.1.18
Xuhua Xia

7. Normal and Thalassemia HBb
----|----|----|----|----|----|----|----|----|----|----|----|--
Normal AUGGUGCACCUGACUCCUGAGGAGAAGUCUGCCGUUACUGCCCUGUGGGGCAAGGUGAACGU
Thalass. AUGGUGCACCUGACUCCUGAGGAGAAGUCUGCCGUUACUGCCCUGUGGGGCAAGGUGAACGU
**************************************************************
--|----|----|----|----|----|----|----|----|----|----|----|----
Normal GGAUGAAGUUGGUGGU-GAGGCCCUGGGCAGGUUGGUAUCAAGGUUACAAGACAGG......
Thalass. GGAUGAAGUUGGUGGUUGAGGCCCUGGGCAGGUUGGUAUCAAGGUUACAAGACAGG......
**************** ***************************************
Are the two genes homologous?
What evolutionary change can you infer from the alignment?
What is the consequence of the evolutionary change?
Xuhua Xia

8. Synonymous mutation = silent mutation?
Do you agree or disagree with the following statement?
see p.27
“A synonymous mutation may not always be silent.”
Fig. 6.23
Xuhua Xia

9. Triplet repeat disorder
- increased copy number of tandem repeats of triplets within
gene (or regulatory region)
- certain human genetic (neurodegenerative) diseases
- repeat number strongly correlates with age of onset of disease
and severity
DM1: Dystrophia myotonica-protein kinase, DMPK on Chr 19
DM2: ZNF9 gene on chromosome 3q21.
HTT on chr 4q16.3
Repeat copy number in normal = red;
orange = carrier;
yellow = disease condition
Gerald Karp Cell and Molecular Biology: Concepts and Experiments p.435
Xuhua Xia
Category I: Huntington’s disease (HD) and the spinocerebellar ataxias, CAG in CDS.
Category II: expansions tend to be more phenotypically diverse with heterogeneous expansions that are generally small in magnitude, but also found in the exons of genes.
Category III: fragile X syndrome, myotonic dystrophy, juvenile myoclonic epilepsy, and Friedreich’s ataxia, non-CDS.

10. Fragile X Syndrome male II-1 asymptomatic hemizygous carrierwt
mutant
male II-1 asymptomatic
hemizygous carrier
daughter III-1 asymptomatic,
but expanded repeat in germ line
Bassell GJ, Warren ST (2008). "Fragile X syndrome: loss of local mRNA regulation alters synaptic development and function". Neuron 60 (2): 201–14.
FMRP from FMR1
Xuhua Xia

11. Huntington’s disease
4p16.3
Xuhua Xia

12. Inversions, translocations, etc.
through chromosome
breakage & rejoining
Fig. 1.20
- shown as single stranded, but both DNA strands inverted
Xuhua Xia

13. Inversions, translocations, etc.
- recombination
between indirect repeats
What would be outcome of
recombination between
direct repeats?
Fig. 1.20
Xuhua Xia

14. Deletion
A B
C D
A D … … … … +
See Fig. 1.17
Xuhua Xia

15. “Hot spots” of mutation
- short direct repeats, palindromes
- alternating Pu-Py dimers (Z-DNA)
- CpG in eukaryotes
-deamination of C to U,
repaired by uracil-DNA
glycolyase
- but 5-methyl C to T
escapes repair
patterns & positions of
mutations not random
Griffiths Fig. 7.16
Xuhua Xia