1. Biotechnology Use of living things to provide needed products or processes

2. Recombinant DNA DNA produced by joining segments of DNA from different sourcesDNA produced by joining segments of DNA from different sources eg. To produce human insulin, scientists have combined bacterial plasmid DNA + human DNAeg. To produce human insulin, scientists have combined bacterial plasmid DNA + human DNA

3. Tools for Producing Recombinant DNA Restriction enzymes: enzymes that cleave the DNA double helix at specific nucleotide sequences

4. Use of the Restriction Enzyme Bam H1 5’— G G A T C C — 3’ 5’— G G A T C C — 3’ 3’— C C T A G G — 5’ 3’— C C T A G G — 5’ 5’— G G A T C C — 3’ 5’— G G A T C C — 3’ 3’— C C T A G G — 5’ 3’— C C T A G G — 5’ sticky end Results in

6. Tools for Producing Recombinant DNA Vector: carrier of DNA; can be virus or plasmid Plasmid: extrachromosomal, independently replicating, small circular DNA molecule

7. Producing Recombinant DNA restriction enzyme Treat source DNA with restriction enzyme Treat plasmid DNA with same enzyme restriction enzyme Mix together Add DNA Ligase Many recombinant DNA molecules are produced, each with a different piece of source DNA Transform bacterial cells Each bacterial cell carries a different recombinant plasmid

8. Tools for Producing Recombinant DNA Probe: sequence of DNA that is complementary to the gene of interest; Used to locate a copy of the gene by hybridization Add Probe Probe Binds to gene AGCTTAGCGATTCGAATCGCTA AATCGC AGCTTAGCGATTCGAATCGCTA Denature DNA by heating

9. Building a DNA Library

10. Finding the Gene of Interest by Screening a Gene Library

11. Applying Your Knowledge A.An enzyme that cleaves DNA at specific sequences is a __________. B.A sequence of DNA that is complementary to the gene of interest is a _________. C.A small, independently replicating DNA molecule is a ___________. 1.Probe 2.Clone 3.Plasmid 4.Restriction Enzyme

12. Biotechnological Methods: PCR Polymerase Chain Reaction (PCR)  Amplifies a specific region in the DNA  Used for identification, especially if the amount of DNA is small  Uses repeated cycles of heating to denature DNA and cooling to synthesize new DNA  Involves the use of ---Taq polymerase (withstands heat) ---Taq polymerase (withstands heat) ---primers to begin synthesis ---primers to begin synthesis

13. Polymerase Chain Reaction: One PCR Cycle Original Double- helix DNA Separate DNA Strands 90 °C Primers & Taq polymerase bind 50 °C Taq Polymerase Primer 72 °C DNA synthesized

14. Polymerase Chain Reaction: Multiple PCR Cycles DNA fragment to be amplified 2 copies4 copies8 copies

15. Biotechnological Methods: RFLP RFLP Analysis Restriction Fragment Length Polymorphism Use of a probe to identify specific DNA fragments derived from restriction enzyme digestion Use of a probe to identify specific DNA fragments derived from restriction enzyme digestion Shows variations in sizes of fragments between different individuals Shows variations in sizes of fragments between different individuals

16. Separation of Restriction Fragments by Size

17. DNA separated by size is transferred from agarose gel to filter DNA on filter is exposed to probe to detect complementary sequences. Southern Blotting for RFLP Analysis

18. Applications of Biotechnology in Agriculture  Transgenic:  Transgenic: organism that contains a gene from another species in all of its cells  Transgenic  Transgenic plants that  Resist  Resist herbicides pests  Have  Have improved storage qualities enhanced nutrition

19. Roundup Ready Soybeans Traditional Soybeans Effects of Treatment with the Herbicide Roundup

20. Bt Corn: Produces its own Pesticide Flavr-Savr Tomato softens more slowly after ripening “Golden” rice with beta-carotene and extra iron

21. Applications of Biotechnology in Agriculture  Transgenic Animals that  Provide models for human diseases  Mice with BRCA1 gene to study inherited breast cancer  “knockout” mouse missing ADA gene to study immune deficiency  Produce pharmaceuticals and release them in milk  Goats producing TPA, tissue plasminogen activator, for treatment of heart attacks

22. C SR CI EC SR CI EM NE EM NE EC SR CI EC SR CI EM NE EM NE E Applications of Biotechnology for Identification: Forensics 1234567 SuspectsSuspects

23. Applications of Biotechnology for Identification: Paternity Testing X X X X X X X X

24. Applications of Biotechnology in Medicine: Therapeutics Pharmaceutical Used for Factor VIII Blood Clotting Human Growth Hormone Pituitary Dwarfism InsulinDiabetes InterferonCancer Vaccine Hepatitis B

25. Applications of Biotechnology in Medicine: Genetic Testing carrier sickle-cell anemia carrier non-carrier

26. Applications of Biotechnology in Medicine: Gene Therapy  Andrew Gobea was diagnosed with ADA deficiency before he was born.  This lack of the ADA enzyme causes an immune deficiency disease called SCID.  Andrew was given the gene for a functional ADA enzyme four days after his birth in 1993.

27.  Umbilical cord blood was collected at birth.  Stem cells were isolated and mixed with a virus carrying a functional ADA gene.  Stem cells were returned to Andrew with the aim of populating his bone marrow with cells that could make the ADA enzyme.

28. Two Years Later  Andrew has been maintained on costly injections of purified ADA enzyme while waiting to see if the gene therapy has been effective.  Tests have shown that the functional ADA gene was introduced into 0.01% of Andrew’s stem cells and this population has given rise to 5-7% of his white blood cells. Is this enough for a cure?

29. Four Years Later  Andrew’s physician decides to taper off the enzyme injections to see if Andrew’s immune system can protect him.  What is the outcome?  What was learned?