2. Welcome to CS262: Computational Genomics Instructor: Serafim Batzoglou TAs: Marc Schaub Andreas Sundquist email: cs262.win08@gmail.com Monday & Wednesday 12:50-2:05 Skilling Auditorium http://cs262.stanford.edu

3. Goals of this course Introduction to Computational Biology & Genomics  Basic concepts and scientific questions  Why does it matter?  Basic biology for computer scientists  In-depth coverage of algorithmic techniques  Current active areas of research Useful algorithms  Dynamic programming  String algorithms  HMMs and other graphical models for sequence analysis

4. Topics in CS262 Part 1: Basic Algorithms  Sequence Alignment & Dynamic Programming  Hidden Markov models, Context Free Grammars, Conditional Random Fields Part 2: Topics in computational genomics and areas of active research  DNA sequencing  Comparative genomics  Genes: finding genes, gene regulation  Proteins, families, and evolution  Networks of protein interactions

5. Course responsibilities Homeworks  4 challenging problem sets, 4-5 problems/pset Due at beginning of class Up to 3 late days (24-hr periods) for the quarter  Collaboration allowed – please give credit Teams of 2 or 3 students Individual writeups If individual (no team) then drop score of worst problem per problem set (Optional) Scribing  Due one week after the lecture, except special permission  Scribing grade replaces 2 lowest problems from all problem sets First-come first-serve, email staff list to sign up

6. Reading material Books  “Biological sequence analysis” by Durbin, Eddy, Krogh, Mitchison Chapters 1-4, 6, 7-8, 9-10  “Algorithms on strings, trees, and sequences” by Gusfield Chapters 5-7, 11-12, 13, 14, 17 Papers Lecture notes

7. Birth of Molecular Biology DNA Phosphate Group Sugar Nitrogenous Base A, C, G, T Physicist Ornithologist

8. G A G U C A G C DNA RNA A - T G - C T  U

9. DNA DNA is written 5’ to 3’ by convention AGACC = GGTCT 3’ 5’ 3’

10. Chromosomes H1DNA H2A, H2B, H3, H4 ~146bp telomere centromere nucleosome chromatin In humans: 2x22 autosomes X, Y sex chromosomes

11. The Genetic Dogma 3’ 5’ 3’ TAGGATCGACTATATGGGATTACAAAGCATTTAGGGA...TCACCCTCTCTAGACTAGCATCTATATAAAACAGAA ATCCTAGCTGATATACCCTAATGTTTCGTAAATCCCT...AGTGGGAGAGATCTGATCGTAGATATATTTTGTCTT AUGGGAUUACAAAGCAUUUAGGGA...UCACCCUCUCUAGACUAGCAUCUAUAUAA (transcription) (translation) Single-stranded RNA protein Double-stranded DNA

12. DNA to RNA to Protein to Cell DNA, ~3x10 9 long in humans Contains ~ 22,000 genes G A G U C A G C messenger-RNA transcriptiontranslationfolding

13. Genetics in the 20 th Century

14. 21 st Century AGTAGCACAGACTACGACGAGA CGATCGTGCGAGCGACGGCGTA GTGTGCTGTACTGTCGTGTGTG TGTACTCTCCTCTCTCTAGTCT ACGTGCTGTATGCGTTAGTGTC GTCGTCTAGTAGTCGCGATGCT CTGATGTTAGAGGATGCACGAT GCTGCTGCTACTAGCGTGCTGC TGCGATGTAGCTGTCGTACGTG TAGTGTGCTGTAAGTCGAGTGT AGCTGGCGATGTATCGTGGT AGTAGGACAGACTACGACGAGACGAT CGTGCGAGCGACGGCGTAGTGTGCTG TACTGTCGTGTGTGTGTACTCTCCTC TCTCTAGTCTACGTGCTGTATGCGTT AGTGTCGTCGTCTAGTAGTCGCGATG CTCTGATGTTAGAGGATGCACGATGC TGCTGCTACTAGCGTGCTGCTGCGAT GTAGCTGTCGTACGTGTAGTGTGCTG TAAGTCGAGTGTAGCTGGCGATGTAT CGTGGT

15. Computational Biology Organize & analyze massive amounts of biological data  Enable biologists to use data  Form testable hypotheses  Discover new biology AGTAGCACAGACTACGACGAGA CGATCGTGCGAGCGACGGCGTA GTGTGCTGTACTGTCGTGTGTG TGTACTCTCCTCTCTCTAGTCT ACGTGCTGTATGCGTTAGTGTC GTCGTCTAGTAGTCGCGATGCT CTGATGTTAGAGGATGCACGAT GCTGCTGCTACTAGCGTGCTGC TGCGATGTAGCTGTCGTACGTG TAGTGTGCTGTAAGTCGAGTGT AGCTGGCGATGTATCGTGGT

16. Some Topics in CS262 1. Sequencing AGTAGCACAGA CTACGACGAGA CGATCGTGCGA GCGACGGCGTA GTGTGCTGTAC TGTCGTGTGTG TGTACTCTCCT 3x10 9 nucleotides ~500 nucleotides

17. Some Topics in CS262 1. Sequencing AGTAGCACAGA CTACGACGAGA CGATCGTGCGA GCGACGGCGTA GTGTGCTGTAC TGTCGTGTGTG TGTACTCTCCT 3x10 9 nucleotides Computational Fragment Assembly Introduced ~1980 1995: assemble up to 1,000,000 long DNA pieces 2000: assemble whole human genome A big puzzle ~60 million pieces

18. Complete genomes today More than 300 complete genomes have been sequenced

19. Where are the genes? 2. Gene Finding In humans: ~22,000 genes ~1.5% of human DNA

20. atg tga ggtgag caggtg cagatg cagttg caggcc ggtgag

21. 3. Molecular Evolution

22. Evolution at the DNA level OK X X Still OK? next generation

23. 4. Sequence Comparison Sequence conservation implies function Sequence comparison is key to Finding genes Determining function Uncovering the evolutionary processes

24. Sequence Comparison—Alignment AGGCTATCACCTGACCTCCAGGCCGATGCCC TAGCTATCACGACCGCGGTCGATTTGCCCGAC -AGGCTATCACCTGACCTCCAGGCCGA--TGCCC--- | | | | | | | | | | | | | x | | | | | | | | | | | TAG-CTATCAC--GACCGC--GGTCGATTTGCCCGAC Sequence Alignment Introduced ~1970 BLAST: 1990, most cited paper in history Still very active area of research query DB BLAST

25. 5. RNA Structure Predict: Given: AGCAGAGUGG … an unfolded RNA sequence AGCACAGUGA … + aligned homologs ACUAGACAGG … CGCCGAGUCG … AGCAGUGUGG … bulge loop helix (stem) hairpin loop internal loop multi- branch loop

26. 6. Protein networks Fresh research area Construct networks from multiple data sources Navigate networks Compare networks across organisms

27. Sequence Alignment

28. Complete DNA Sequences More than 300 complete genomes have been sequenced

29. Evolution

30. Evolution at the DNA level …ACGGTGCAGTTACCA… …AC----CAGTCCACCA… Mutation SEQUENCE EDITS REARRANGEMENTS Deletion Inversion Translocation Duplication

31. Evolutionary Rates OK X X Still OK? next generation

32. Sequence conservation implies function Alignment is the key to Finding important regions Determining function Uncovering evolutionary events

33. Sequence Alignment -AGGCTATCACCTGACCTCCAGGCCGA--TGCCC--- TAG-CTATCAC--GACCGC--GGTCGATTTGCCCGAC Definition Given two strings x = x 1 x 2...x M, y = y 1 y 2 …y N, an alignment is an assignment of gaps to positions 0,…, N in x, and 0,…, N in y, so as to line up each letter in one sequence with either a letter, or a gap in the other sequence AGGCTATCACCTGACCTCCAGGCCGATGCCC TAGCTATCACGACCGCGGTCGATTTGCCCGAC

34. What is a good alignment? AGGCTAGTT, AGCGAAGTTT AGGCTAGTT- 6 matches, 3 mismatches, 1 gap AGCGAAGTTT AGGCTA-GTT- 7 matches, 1 mismatch, 3 gaps AG-CGAAGTTT AGGC-TA-GTT- 7 matches, 0 mismatches, 5 gaps AG-CG-AAGTTT

35. Scoring Function Sequence edits: AGGCCTC  MutationsAGGACTC  InsertionsAGGGCCTC  DeletionsAGG. CTC Scoring Function: Match: +m Mismatch: -s Gap:-d Score F = (# matches)  m - (# mismatches)  s – (#gaps)  d Alternative definition: minimal edit distance “Given two strings x, y, find minimum # of edits (insertions, deletions, mutations) to transform one string to the other”

36. How do we compute the best alignment? AGTGCCCTGGAACCCTGACGGTGGGTCACAAAACTTCTGGA AGTGACCTGGGAAGACCCTGACCCTGGGTCACAAAACTC Too many possible alignments: >> 2 N (exercise)

37. Alignment is additive Observation: The score of aligningx 1 ……x M y 1 ……y N is additive Say thatx 1 …x i x i+1 …x M aligns to y 1 …y j y j+1 …y N The two scores add up: F(x[1:M], y[1:N]) = F(x[1:i], y[1:j]) + F(x[i+1:M], y[j+1:N])

38. Dynamic Programming There are only a polynomial number of subproblems  Align x 1 …x i to y 1 …y j Original problem is one of the subproblems  Align x 1 …x M to y 1 …y N Each subproblem is easily solved from smaller subproblems  We will show next Dynamic Programming!!!Then, we can apply Dynamic Programming!!! Let F(i, j) = optimal score of aligning x 1 ……x i y 1 ……y j F is the DP “Matrix” or “Table” “Memoization”

39. Dynamic Programming (cont’d) Notice three possible cases: 1.x i aligns to y j x 1 ……x i-1 x i y 1 ……y j-1 y j 2.x i aligns to a gap x 1 ……x i-1 x i y 1 ……y j - 3.y j aligns to a gap x 1 ……x i - y 1 ……y j-1 y j m, if x i = y j F(i, j) = F(i – 1, j – 1) + -s, if not F(i, j) = F(i – 1, j) – d F(i, j) = F(i, j – 1) – d

40. Dynamic Programming (cont’d) How do we know which case is correct? Inductive assumption: F(i, j – 1), F(i – 1, j), F(i – 1, j – 1) are optimal Then, F(i – 1, j – 1) + s(x i, y j ) F(i, j) = max F(i – 1, j) – d F(i, j – 1) – d Where s(x i, y j ) = m, if x i = y j ;-s, if not

41. G - AGTA 0-2-3-4 A10 -2 T 0010 A-3 02 F(i,j) i = 0 1 2 3 4 Example x = AGTAm = 1 y = ATAs = -1 d = -1 j = 0 1 2 3 F(1, 1) = max{F(0,0) + s(A, A), F(0, 1) – d, F(1, 0) – d} = max{0 + 1, – 1, – 1} = 1 AAAA TTTT AAAA Procedure to output Alignment Follow the backpointers When diagonal, OUTPUT x i, y j When up, OUTPUT y j When left, OUTPUT x i

42. The Needleman-Wunsch Matrix x 1 ……………………………… x M y 1 ……………………………… y N Every nondecreasing path from (0,0) to (M, N) corresponds to an alignment of the two sequences An optimal alignment is composed of optimal subalignments

43. The Needleman-Wunsch Algorithm 1.Initialization. a.F(0, 0) = 0 b.F(0, j) = - j  d c.F(i, 0)= - i  d 2.Main Iteration. Filling-in partial alignments a.For each i = 1……M For each j = 1……N F(i – 1,j – 1) + s(x i, y j ) [case 1] F(i, j) = max F(i – 1, j) – d [case 2] F(i, j – 1) – d [case 3] DIAG, if [case 1] Ptr(i, j)= LEFT,if [case 2] UP,if [case 3] 3.Termination. F(M, N) is the optimal score, and from Ptr(M, N) can trace back optimal alignment

44. Performance Time: O(NM) Space: O(NM) Later we will cover more efficient methods

45. A variant of the basic algorithm: Maybe it is OK to have an unlimited # of gaps in the beginning and end: ----------CTATCACCTGACCTCCAGGCCGATGCCCCTTCCGGC ||||||| |||| | || || GCGAGTTCATCTATCAC--GACCGC--GGTCG-------------- Then, we don’t want to penalize gaps in the ends

46. Different types of overlaps Example: 2 overlapping“reads” from a sequencing project – recall Lecture 1 Example: Search for a mouse gene within a human chromosome

47. The Overlap Detection variant Changes: 1.Initialization For all i, j, F(i, 0) = 0 F(0, j) = 0 2.Termination max i F(i, N) F OPT = max max j F(M, j) x 1 ……………………………… x M y 1 ……………………………… y N

48. The local alignment problem Given two strings x = x 1 ……x M, y = y 1 ……y N Find substrings x’, y’ whose similarity (optimal global alignment value) is maximum x = aaaacccccggggtta y = ttcccgggaaccaacc

49. Why local alignment – examples Genes are shuffled between genomes Portions of proteins (domains) are often conserved

50. Cross-species genome similarity 98% of genes are conserved between any two mammals >70% average similarity in protein sequence hum_a : GTTGACAATAGAGGGTCTGGCAGAGGCTC--------------------- @ 57331/400001 mus_a : GCTGACAATAGAGGGGCTGGCAGAGGCTC--------------------- @ 78560/400001 rat_a : GCTGACAATAGAGGGGCTGGCAGAGACTC--------------------- @ 112658/369938 fug_a : TTTGTTGATGGGGAGCGTGCATTAATTTCAGGCTATTGTTAACAGGCTCG @ 36008/68174 hum_a : CTGGCCGCGGTGCGGAGCGTCTGGAGCGGAGCACGCGCTGTCAGCTGGTG @ 57381/400001 mus_a : CTGGCCCCGGTGCGGAGCGTCTGGAGCGGAGCACGCGCTGTCAGCTGGTG @ 78610/400001 rat_a : CTGGCCCCGGTGCGGAGCGTCTGGAGCGGAGCACGCGCTGTCAGCTGGTG @ 112708/369938 fug_a : TGGGCCGAGGTGTTGGATGGCCTGAGTGAAGCACGCGCTGTCAGCTGGCG @ 36058/68174 hum_a : AGCGCACTCTCCTTTCAGGCAGCTCCCCGGGGAGCTGTGCGGCCACATTT @ 57431/400001 mus_a : AGCGCACTCG-CTTTCAGGCCGCTCCCCGGGGAGCTGAGCGGCCACATTT @ 78659/400001 rat_a : AGCGCACTCG-CTTTCAGGCCGCTCCCCGGGGAGCTGCGCGGCCACATTT @ 112757/369938 fug_a : AGCGCTCGCG------------------------AGTCCCTGCCGTGTCC @ 36084/68174 hum_a : AACACCATCATCACCCCTCCCCGGCCTCCTCAACCTCGGCCTCCTCCTCG @ 57481/400001 mus_a : AACACCGTCGTCA-CCCTCCCCGGCCTCCTCAACCTCGGCCTCCTCCTCG @ 78708/400001 rat_a : AACACCGTCGTCA-CCCTCCCCGGCCTCCTCAACCTCGGCCTCCTCCTCG @ 112806/369938 fug_a : CCGAGGACCCTGA------------------------------------- @ 36097/68174 “atoh” enhancer in human, mouse, rat, fugu fish

51. The Smith-Waterman algorithm Idea: Ignore badly aligning regions Modifications to Needleman-Wunsch: Initialization:F(0, j) = F(i, 0) = 0 0 Iteration:F(i, j) = max F(i – 1, j) – d F(i, j – 1) – d F(i – 1, j – 1) + s(x i, y j )

52. The Smith-Waterman algorithm Termination: 1.If we want the best local alignment… F OPT = max i,j F(i, j) Find F OPT and trace back 2.If we want all local alignments scoring > t ??For all i, j find F(i, j) > t, and trace back? Complicated by overlapping local alignments Waterman–Eggert ’87: find all non-overlapping local alignments with minimal recalculation of the DP matrix

53. Scoring the gaps more accurately Current model: Gap of length n incurs penaltyn  d However, gaps usually occur in bunches Convex gap penalty function:  (n): for all n,  (n + 1) -  (n)   (n) -  (n – 1)  (n)

54. Convex gap dynamic programming Initialization:same Iteration: F(i – 1, j – 1) + s(x i, y j ) F(i, j) = maxmax k=0…i-1 F(k, j) –  (i – k) max k=0…j-1 F(i, k) –  (j – k) Termination: same Running Time: O(N 2 M)(assume N>M) Space: O(NM)

55. Compromise: affine gaps  (n) = d + (n – 1)  e || gap gap open extend To compute optimal alignment, At position i, j, need to “remember” best score if gap is open best score if gap is not open F(i, j):score of alignment x 1 …x i to y 1 …y j if if x i aligns to y j if G(i, j):score if x i aligns to a gap after y j if H(i, j): score if y j aligns to a gap after x i V(i, j) = best score of alignment x 1 …x i to y 1 …y j d e  (n)

56. Needleman-Wunsch with affine gaps Why do we need matrices F, G, H? x i aligns to y j x 1 ……x i-1 x i x i+1 y 1 ……y j-1 y j - x i aligns to a gap after y j x 1 ……x i-1 x i x i+1 y 1 ……y j …- - Add -d Add -e G(i+1, j) = F(i, j) – d G(i+1, j) = G(i, j) – e Because, perhaps G(i, j) < V(i, j) (it is best to align x i to y j if we were aligning only x 1 …x i to y 1 …y j and not the rest of x, y), but on the contrary G(i, j) – e > V(i, j) – d (i.e., had we “fixed” our decision that x i aligns to y j, we could regret it at the next step when aligning x 1 …x i+1 to y 1 …y j )

57. Needleman-Wunsch with affine gaps Initialization:V(i, 0) = d + (i – 1)  e V(0, j) = d + (j – 1)  e Iteration: V(i, j) = max{ F(i, j), G(i, j), H(i, j) } F(i, j) = V(i – 1, j – 1) + s(x i, y j ) V(i – 1, j) – d G(i, j) = max G(i – 1, j) – e V(i, j – 1) – d H(i, j) = max H(i, j – 1) – e Termination: V(i, j) has the best alignment Time? Space?

58. To generalize a bit… … think of how you would compute optimal alignment with this gap function ….in time O(MN)  (n)

59. Bounded Dynamic Programming Assume we know that x and y are very similar Assumption: # gaps(x, y) < k(N) xixi Then,|implies | i – j | < k(N) yj yj We can align x and y more efficiently: Time, Space: O(N  k(N)) << O(N 2 )

60. Bounded Dynamic Programming Initialization: F(i,0), F(0,j) undefined for i, j > k Iteration: For i = 1…M For j = max(1, i – k)…min(N, i+k) F(i – 1, j – 1)+ s(x i, y j ) F(i, j) = maxF(i, j – 1) – d, if j > i – k(N) F(i – 1, j) – d, if j < i + k(N) Termination:same Easy to extend to the affine gap case x 1 ………………………… x M y 1 ………………………… y N k(N)

61. Recap Dynamic Programming Global sequence alignment  Needleman–Wunsch  Overlap detection  Banded alignment  Convex gaps  Affine gaps Local sequence alignment  Smith-Waterman

62. Computer Scientists vs Biologists

63. Computer scientists vs Biologists Nothing is ever true or false in Biology Everything is true or false in computer science

64. Computer scientists vs Biologists Biologists strive to understand the complicated, messy natural world Computer scientists seek to build their own clean and organized virtual worlds

65. Biologists are obsessed with being the first to discover something Computer scientists are obsessed with being the first to invent or prove something Computer scientists vs Biologists

66. Biologists are comfortable with the idea that all data have errors Computer scientists are not Computer scientists vs Biologists

67. Computer scientists get high-paid jobs after graduation Biologists typically have to complete one or more 5-year post-docs... Computer scientists vs Biologists

68. Computer Science is to Biology what Mathematics is to Physics