Download presentation
Presentation is loading. Please wait.
1
Translational Inhibition in Arabidopsis thaliana Russell Burke Dr. James Carrington Botany and Plant Pathology
2
Significance microRNAs are 21 to 24 nucleotide RNAs that serve in post-transcriptional regulation in nearly all eukaryotic organisms They have large roles in growth, development, stress response and antiviral defense in plants Having a greater knowledge of miRNAs will allow us to better understand growth and development of agriculturally useful plants microRNA regulation in plants is also very similar to animals and may lead to a better understanding of cancer and other human diseases
3
RNA Silencing Pathways – Basic Mechanisms and Functions dsRNA or RNA foldback RNA Dependent RNA Polymerase Dicer-like Small RNA Duplex Argonaute Target mRNA RNA-induced silencing complex
4
RDR3 RDR2 RDR6 DCL1 DCL2 DCL3 DCL4 AGO1 AGO2 AGO3 AGO4 AGO5 AGO6 AGO7 AGO8 AGO9 AGO10 RDR1 RDR5 RDR4 Major Small RNA Biogenesis and Effector Families RNA Silencing Pathways – Basic Mechanisms and Functions dsRNA or RNA foldback RNA Dependent RNA Polymerase Dicer-like Small RNA Duplex Argonaute Target mRNA RNA-induced silencing complex
5
DRB DCL3 RDR2 24 nt siRNA pathway DRB4 DCL4 RDR6 tasiRNA (21 nt siRNA) pathway HYL1 DCL1 SE Small RNA Classes Function Through Sets of ARGONAUTEs miRNA pathway Targets – messenger RNA, a few noncoding RNA Targets – messenger RNA, virus RNA, transposons Targets – transposons, repeated sequences
6
DRB DCL3 RDR2 24 nt siRNA pathway DRB4 DCL4 RDR6 HYL1 DCL1 SE Small RNA Classes Function Through Sets of ARGONAUTEs miRNA pathway AnAn ARF8 mRNA AGO1 miR167 Posttranscriptional silencing Targets – messenger RNA, a few noncoding RNA Targets – messenger RNA, virus RNA, transposons Targets – transposons, repeated sequences tasiRNA (21 nt siRNA) pathway
7
DRB DCL3 RDR2 AGO4AGO6 DRB4 DCL4 RDR6 AGO2 AGO5 HYL1 DCL1 SE AGO1AGO10 Small RNA Classes Function Through Sets of ARGONAUTEs AGO7 AGO3AGO8AGO9 24 nt siRNA pathwaymiRNA pathway AnAn ARF8 mRNA AGO1 miR167 Transcriptional silencing Posttranscriptional silencing Targets – messenger RNA, a few noncoding RNA Targets – messenger RNA, virus RNA, transposons Targets – transposons, repeated sequences tasiRNA (21 nt siRNA) pathway
8
DRB DCL3 RDR2 AGO4AGO6 DRB4 DCL4 RDR6 AGO2 AGO5 HYL1 DCL1 SE AGO1AGO10 Small RNA Classes Function Through Sets of ARGONAUTEs AGO7 AGO3AGO8AGO9 24 nt siRNA pathwaymiRNA pathway AnAn ARF8 mRNA AGO1 miR167 Posttranscriptional silencing Targets – messenger RNA, a few noncoding RNA Targets – messenger RNA, virus RNA, transposons Targets – transposons, repeated sequences tasiRNA (21 nt siRNA) pathway Col-0ago1-25
9
Broderson et al. (2008) Science Translational inhibition found in Arabidopsis mutants
10
Problems with translational inhibition experiment Protein levels are not quantified Experiments are done in mutant Arabidopsis plants Difficult to know all the consequences of anago1 mutant Only 3 specific cases of potential inhibition are shown Broderson et al. (2008) Science Translational inhibition found in Arabidopsis mutants
11
Exogenous Infiltration of Nicotiana benthamiana Protein Assay mRNA Analysis Transiently express GFP in N. benthamiana using a 35S promoter Allows us to express RNA and proteins in a consistent manner Avoids consequences of AGO1 mutation and other endogenous background We can use the same microRNA to target various GFP constructs GFP
12
Exogenous Infiltration of Nicotiana benthamiana Designed two different GFP mRNAs, that are both targets of an artificial microRNA Perfect complementation between the microRNA and mRNA target leads to cleavage of the mRNA By changing the serine codon in the target site, the mRNA is not cleaved by the microRNA
13
GFPGFPser2 GUS GFPGFPser2 amiR GFP GFP mRNA GFP Exogenous Infiltration of Nicotiana benthamiana
14
GFPGFPser2 GUS GFPGFPser2 amiR GFP GFP mRNA GFP
15
5’GATATTGGCGCGGCTCAATCA 3’ ||||||||||||||||||||| 3’CTATAACCGCGCCGAGTTAGT 5’ 5’TTGCTTACTCTCTTCTGTCA 3’ |||| |||||||||||||| 3’CACGAGTGAGAGAAGACAGT 5’ miR171 SCL6-IV Target 35S Sensor Constructs target smGFP miR156 SPL3 Target 5’AAGGGGTTTCCTGAGATCACA 3’ ||||||| ||||||| |||| 3’TTCCCCACTGGACTCTTGTGT 5’ miR398 CSD1 Target 5’CTACTGCCGCTACTGCTACCA 3’ |||| ||||||||||||||| 3’AATGGTGGCGATGACGATGGT 5’ miR834 CIP4 Target TUMV 3’ utr 5’GATATTGGCGATTCTCAATCA 3’ |||||||||| |||||||| 3’CTATAACCGCGCCGAGTTAGT 5’ 5’TTGCTTACTAGATTCTGTCA 3’ |||| ||| |||||||| 3’CACGAGTGAGAGAAGACAGT 5’ miR171 SCL6-IV mTarget miR156 SPL3 mTarget 5’AAGGGGTTTCAGTAGATCACA 3’ ||||||| | ||| |||| 3’TTCCCCACTGGACTCTTGTGT 5’ miR398 CSD1 mTarget 5’CTACTGCCGCGCATGCTACCA 3’ |||| ||||| ||||||| 3’AATGGTGGCGATGACGATGGT 5’ miR834 CIP4 mTarget Next steps in GFP translational repression Constructs can be introduced into Arabidopsis where translation of GFP can be analyzed endogenously
16
Acknowledgements Howard Hughes Medical Institute Cripps Scholarship Fund, College of Science Mentors: – Dr. James Carrington – Josh Cuperus Kevin Ahern
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.