Presentation is loading. Please wait.

Presentation is loading. Please wait.

WARMUP Give three differences and three similarities between DNA and RNA.

Similar presentations


Presentation on theme: "WARMUP Give three differences and three similarities between DNA and RNA."— Presentation transcript:

1 WARMUP Give three differences and three similarities between DNA and RNA

2 WARMUP Use the following words to write a summary of transcription:
5’ cap, poly-A tail, introns, exons, pre-mRNA, mature mRNA, template strand, spliceosome, snRNPs, terminator, promoter, RNA Polymerase. Bonus, properly use transcription factors, TATA Box, ribozymes

3 From Gene to Protein How Genes Work
4/16/2017

4 What do genes code for? How does DNA code for cells & bodies? DNA
how are cells and bodies made from the instructions in DNA DNA proteins cells bodies

5 DNA gets all the glory, but proteins do all the work!
The “Central Dogma” Flow of genetic information in a cell How do we move information from DNA to proteins? transcription translation DNA RNA protein trait To get from the chemical language of DNA to the chemical language of proteins requires 2 major stages: transcription and translation DNA gets all the glory, but proteins do all the work! replication

6 Metabolism taught us about genes
Inheritance of metabolic diseases suggested that genes coded for enzymes each disease (phenotype) is caused by non-functional gene product lack of an enzyme Tay sachs PKU (phenylketonuria) albinism Am I just the sum of my proteins? metabolic pathway disease disease disease disease A B C D E enzyme 1 enzyme 2 enzyme 3 enzyme 4

7 one gene : one enzyme hypothesis
1941 | 1958 Beadle & Tatum one gene : one enzyme hypothesis George Beadle Edward Tatum "for their discovery that genes act by regulating definite chemical events"

8 Beadle & Tatum Wild-type Neurospora Minimal medium Select one of
the spores Grow on complete medium control Nucleic acid Choline Pyridoxine Riboflavin Arginine Minimal media supplemented only with… Thiamine Folic Niacin Inositol p-Amino benzoic acid Test on minimal medium to confirm presence of mutation Growth on complete X rays or ultraviolet light asexual spores create mutations positive control negative control mutation identified experimentals amino acid supplements

9 Another view:

10 Still need more help to get this?
Click on the picture

11 DNA mRNA protein trait From gene to protein nucleus cytoplasm
aa From gene to protein nucleus cytoplasm transcription translation DNA mRNA protein ribosome trait

12 from DNA nucleic acid language to RNA nucleic acid language
Transcription from DNA nucleic acid language to RNA nucleic acid language 4/16/2017

13 DNA RNA RNA ribose sugar N-bases single stranded lots of RNAs
uracil instead of thymine U : A C : G single stranded lots of RNAs mRNA, tRNA, rRNA, siRNA… transcription DNA RNA

14 Transcription Making mRNA transcribed DNA strand = template strand
untranscribed DNA strand = coding strand same sequence as RNA synthesis of complementary RNA strand transcription bubble enzyme RNA polymerase coding strand 3 A G C A T C G T 5 A G A A A G T C T T C T C A T A C G DNA T 3 C G T A A T 5 G G C A U C G U T 3 C unwinding G T A G C A rewinding mRNA RNA polymerase template strand build RNA 53 5

15 Matching bases of DNA & RNA
Match RNA bases to DNA bases on one of the DNA strands C U G A G U G U C U G C A A C U A A G C RNA polymerase U 5' A 3' G A C C T G G T A C A G C T A G T C A T C G T A C C G T

16 Eukaryotic genes have junk!
Eukaryotic genes are not continuous exons = the real gene expressed / coding DNA introns = the junk inbetween sequence introns come out! intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence

17 mRNA splicing Post-transcriptional processing
eukaryotic mRNA needs work after transcription primary transcript = pre-mRNA mRNA splicing edit out introns make mature mRNA transcript eukaryotic RNA is about 10% of eukaryotic gene. intron = noncoding (inbetween) sequence ~10,000 bases eukaryotic DNA exon = coding (expressed) sequence pre-mRNA primary mRNA transcript ~1,000 bases mature mRNA transcript spliced mRNA

18 Splicing must be accurate
No room for mistakes! a single base added or lost throws off the reading frame AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP|

19 RNA splicing enzymes snRNPs Spliceosome several snRNPs
small nuclear RNA proteins Spliceosome several snRNPs recognize splice site sequence cut & paste gene snRNPs exon intron snRNA 5' 3' spliceosome exon excised intron 5' 3' lariat mature mRNA No, not smurfs! “snurps”

20 Starting to get hard to define a gene!
Alternative splicing Alternative mRNAs produced from same gene when is an intron not an intron… different segments treated as exons Starting to get hard to define a gene!

21 More post-transcriptional processing
Need to protect mRNA on its trip from nucleus to cytoplasm enzymes in cytoplasm attack mRNA protect the ends of the molecule add 5 GTP cap add poly-A tail longer tail, mRNA lasts longer: produces more protein eukaryotic RNA is about 10% of eukaryotic gene. A 3' poly-A tail mRNA 5' 5' cap 3' G P A’s

22 DNA mRNA protein trait From gene to protein nucleus cytoplasm
aa From gene to protein nucleus cytoplasm transcription translation DNA mRNA protein ribosome trait

23 Transcription (Click to view)

24 What color would a smurf turn if he held his breath?
Any Questions?? What color would a smurf turn if he held his breath? 4/16/2017


Download ppt "WARMUP Give three differences and three similarities between DNA and RNA."

Similar presentations


Ads by Google