Download presentation
Presentation is loading. Please wait.
Published byDaniella Scott Modified over 9 years ago
3
How does the graph represent a gel? Each group filled in a ‘band’ that represents where different – sized DNA fragments would have migrated on a gel, with smaller fragments migrating farther. Why is each group’s ‘lane’ different? Each group had a unique DNA sequence, and so that fragments produced by cutting with the restriction enzyme differ. Is it possible for two different people to produce the same RFLP pattern? Yes, but it is very unlikely, especially if multiple different restriction enzymes are used. Moreover, the odds can be estimated.
4
A woman is violently killed, and her hands have defensive injuries indicating that she fought her attacker. Investigators find skin cells under her nails. They extract the DNA from these cells, amplify it, and run an RFLP analysis. Do any of the suspects have matching DNA?
5
Different RFLPs are referred to as alleles. To analyze RFLPs for paternity, remember: any alleles in a child that didn’t come from mother must come from father. Who is the father? First match child to mom Then, match remaining alleles to father
6
Why can’t #1 or #3 be the father? Neither has all the ‘missing’ alleles. Is the real father the one who shares the most alleles with the child? No. Its possible to have a lot of alleles in common and not be the dad. Can you determine paternity without having the mother’s DNA? Not using this method, and not as accurately.
7
Is Darth Vader really Luke’s father?
8
Justify your answer by matching the alleles. Yes – he is the father. Every allele in Luke & Leia match an allele found in Anakin’s or Padme’s results. But there’s still a problem … see it? Luke and Leia aren’t identical twins!
9
Dad #4 All of the child’s alleles match up with either mom or dad #4.
10
Is there any other time when you might need to compare the DNA of family members to solve a crime? Missing persons cases Watch me!
11
STR stands for short tandem repeat These are places (loci) in DNA that contain a variable number of a short, repeated sequence of nucleotides. E.g. AGCAGCAGCAGCAGCAGCAGC (7 repeats) or AGCAGCAGCAGCAGC (5 repeats) The number of repeats are person has is their allele for that STR loci. Each person has two versions of every chromosome, so they have 2 alleles. (E.g. 6, 10 for a particular STR)
12
1. DNA is collected and extracted. 2. Regions containing each STR loci are amplified and separated according to size using automated technologies. Why automated technology? Because the difference in size between different alleles can be miniscule – far too small to see in a gel done by hand. 3. Evidence can be matched to a suspect and/or entered into a DNA database (CODIS). In the US, investigator routinely analyze 13 STR loci. 4. Frequencies of different alleles are known, so that probability of random matches can be calculated.
13
What do the numbers mean? That is the number of repeats for that loci Why are their two numbers per loci? Each person has two alleles per loci Why are some alleles not whole numbers? Some repeats may not be completed (e.g. ACGACGA)
14
Which suspect matches the evidence? Suspect B How could we calculate the probability that the suspect matched by chance? If we knew the frequency of each allele in the general population, we could multiply all the probabilities.
15
Calculate the frequency of this combination of STR genotypes..000000006% Or About 6 in 10 billion Is it likely that someone else in the world has this same genotype? Yes! The world has 7 billion people. What does this mean for matching a suspect to a crime scene? What about for matching a sample to a DNA data base?
16
Who is the baby daddy? - Richard How do you know? - Every allele in the child came from mother or Richard How can you exclude the others? STR LociMotherChildStephenRichardCharles D35S135815, 1615, 1716, 1717, 1715, 15 vWA16, 1915, 1616, 2015, 1915, 16 FGA21, 2121, 2322, 2623, 2723, 26 D8S117912, 1513, 1515, 1512, 1311, 13 D21S1130, 30.230.2, 30.230, 30.228, 30.230, 30.2 D18S5118, 1812, 1814, 1812, 1215, 18 D5S81812, 1313, 1310, 139, 1310, 12 D13S31711, 1212, 1212, 1311, 12 D7S82010, 11 11, 1211, 1310, 13 CSF1PO8, 88, 119, 99, 11 TPOX7,88, 88, 10 7, 10 THO16, 9.39.3, 9.36, 66, 9.36, 8 D16S53911, 139, 1311, 139, 1211, 12
17
DNA is amplified using a small fraction of special nucleotides that will end the formation of a chain early. › Since the inclusion of these special nucleotides is random and since the process is repeated MANY MANY MANY times, you eventually wind up with a set of different strands, each one base pair different in length, each ending in a special nucleotide. These special, ending nucleotides are labeled in some way (i.e. radioactively, with dye, etc.) so that a machine can tell the difference between A, C, G, and T These fragments are then sorted by size, and the special nucleotides are ‘read’ by the machine to form the sequence. Watch me!
18
What were our objectives, and what did we learn? What was our learner profile trait and how did we demonstrate it? How does what we did today tie to our unit question?
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.