5. R r R r R r R r R r R r R r

6. The “Gurdon” experiment: Does every cell in an organism contain all the genetic information to make a complete individual?

7. Unfertilized egg Ultraviolet radiation of egg to destroy nucleus Enucleated egg Host egg

8. Donor nucleus

9. Host eggDonor nucleus

10. How is genetic information copied every time a cell divides? The two strands separate and each strand is used as a template for the synthesis of a new strand.

11. How is genetic information copied every time a cell divides? DNA polymerase is the enzyme (protein) that carries out DNA replication.

12. Bacteria have about 5 million basepairs of DNA. Bacteria can divide every 20 minutes. DNA polymerase replicates bacterial DNA at a rate of 4200 basepairs/second.

13. What is a gene? Genes are the basic units of inheritance. Genes are information to make proteins. one gene one protein

14. Most higher organisms have 15,000 - 35,000 different genes These organisms have the information (DNA) to make 15,000 - 35,000 different proteins

15. How is genetic information stored in DNA? As a sequence of bases (ATGCATTCGCAATT…)

16. the sequence of amino acids in a protein. the 3-D shape of the protein. the function of the protein. The sequence of bases in DNA determines The sequence of amino acids in a protein determines The 3-D shape of the protein determines

17. Hemoglobin

18. DNA Polymerase

19. DNA cutting enzyme

20. Receptor protein

21. Genes are arranged on chromosomes like beads on a string Gene 1Gene 2Gene 3Gene 4Gene 5 DNA

22. A typical chromosome has thousands of genes Humans have 23 pairs of chromosomes (46 total) Fruit Flies have 4 pairs of chromosomes (8 total) Arabidopsis has 5 pairs of chromosomes (10 total) Gene 1Gene 2Gene 3Gene 4Gene 5 Chromosome

23. Genes code for proteins Gene 1Gene 2Gene 3Gene 4Gene 5 chromosome Protein 1Protein 2Protein 3Protein 4Protein 5

24. Central Dogma of Biology

25. DNA RNA cytoplasm nucleus Transcription: DNA RNA

26. DNA RNA cytoplasm RNA is transported to cytoplasm nucleus

27. DNA protein RNA cytoplasm Translation: RNA protein nucleus

28. DNA RNA protein RNA cytoplasm DNA RNA protein nucleus

29. Properties of DNA Double stranded Deoxyribonucleic acid Bases: A, G, C and T Properties of RNA Single stranded Ribonucleic acid Bases: A, G, C and U (U = uracil)

30. … GGC TGT GGC TAG … CCG ACA CCG ATC … GGC UGU GGC UAG DNA (bases) RNA (bases) Central Dogma of Biology DNA RNA protein transcription

31. The code in RNA is read three bases at a time translationtranscription

32. … GGC TGT GGC TAG … CCG ACA CCG ATC … GGC UGU GGC UAG … Gly DNA (bases) RNA (bases) Protein (amino acids) Central Dogma of Biology DNA RNA protein transcription translation

33. … GGC TGT GGC TAG … CCG ACA CCG ATC … GGC UGU GGC UAG … Gly - Cys DNA (bases) RNA (bases) Protein (amino acids) Central Dogma of Biology DNA RNA protein transcription translation

34. … GGC TGT GGC TAG … CCG ACA CCG ATC … GGC UGU GGC UAG … Gly - Cys - Gly DNA (bases) RNA (bases) Protein (amino acids) Central Dogma of Biology DNA RNA protein transcription translation

35. … GGC TGT GGC TAG … CCG ACA CCG ATC … GGC UGU GGC UAG … Gly - Cys - Gly Stop DNA (bases) RNA (bases) Protein (amino acids) Central Dogma of Biology DNA RNA protein transcription translation

36. The Genetic Code is Universal AUG codes for the amino acid methionine in all organisms (bacteria, fungi, plants, and animals) GGC codes for the amino acid glycine in all organisms (bacteria, fungi, plants, and animals)

37. The Genetic Code is Universal This fact proves one of Darwin’s most remarkable predictions: All life forms evolved from a common ancestor.

38. What is a mutation? A mutation is a change in the base sequence in DNA that results in a change in the amino acid sequence of a protein.

39. … GGC TGT GGC TAG … CCG ACA CCG ATC DNA … GGC TAT GGC TAG … CCG ATA CCG ATC normal mutant RNA … GGC UAU GGC UAG transcription … GGC UGU GGC UAG transcription … Gly - Protein translation Cys- GlyStopTyr- GlyStop

40. ON OFF regulatory region (on/off switch) coding region (codes for amino acids) A gene is composed of two parts:

41. Transcription factors turn genes on and off. Transcription factors are proteins that bind to a specific base sequence in DNA. …AGCCTACCAAAAAAGGTTCCA CG… …TCGGATGGTTTTTTCCAAGGT GC…

42. regulatory region (on/off switch) coding region (codes for amino acids) - Some transcription factors are activators: They turn genes ON.

43. regulatory region (on/off switch) coding region (codes for amino acids) - Some transcription factors are activators: They turn genes ON. - Some transcription factors are repressors: They turn genes OFF.