Presentation is loading. Please wait.

Presentation is loading. Please wait.

Multiple Sequence Alignment. An alignment of heads.

Similar presentations


Presentation on theme: "Multiple Sequence Alignment. An alignment of heads."— Presentation transcript:

1 Multiple Sequence Alignment

2 An alignment of heads

3 Sequence Alignment A way of arranging the primary sequences of DNA, RNA and amino acid to identify the regions of similarity that may be a consequence of functional, structural or evolutionary relationship between the sequences.

4 Goals To establish an hypothesis of positional homology between bases/amino acids. To generate a concise, information-rich summary of sequence data. Sometimes used to illustrate the dissimilarity between a group of sequences. Alignments can be treated as models that can be used to test hypotheses.

5 Sequence Alignment Aligned sequences of nucleotide or amino acid residues are typically represented as rows within a matrix. Gaps (symbol “-”) are inserted between the residues so that residues with identical or similar characters are aligned. GGGAATCTAGGACTATACCGGATCTA GGGAATCTA--ACTATA--GGATCTA GGG--TCTAGGACTATACCGGAT--A Taxon A Taxon B Taxon C

6 Alignment can be easy or difficult Easy Difficult due to insertions or deletions (indels)

7

8 Protein Alignment may be guided by Tertiary Structure Interactions Homo sapiens DjlA protein Escherichia coli DjlA protein

9 Multiple Sequence Alignment- Approaches 3 main approaches of alignment: -Manual -Automatic -Combined

10 Manual Alignment Might be carried out because: -Alignment is easy. -There is some extraneous information (structural). -Automated alignment methods have encountered the local minimum problem. -An automated alignment method can be “improved”.

11 Automatic Alignment: Progressive Approach Devised by Feng and Doolittle in 1987. Essentially a heuristic method and as such is not guaranteed to find the ‘optimal’ alignment. Requires n-1+n-2+n-3...n-n+1 pairwise alignments as a starting point. Most successful implementation is CLUSTAL.

12 Overview of ClustalW Procedure 1 PEEKSAVTALWGKVN--VDEVGG 2 GEEKAAVLALWDKVN--EEEVGG 3 PADKTNVKAAWGKVGAHAGEYGA 4 AADKTNVKAAWSKVGGHAGEYGA 5 EHEWQLVLHVWAKVEADVAGHGQ Hbb_Human 1 - Hbb_Horse 2.17 - Hba_Human 3.59.60 - Hba_Horse 4.59.59.13 - Myg_Whale 5.77.77.75.75 - Hbb_Human Hbb_Horse Hba_Horse Hba_Human Myg_Whale 2 1 3 4 2 1 3 4 alpha-helices Quick pairwise alignment: calculate distance matrix Neighbor-joining tree (guide tree) Progressive alignment following guide tree ClustalW


Download ppt "Multiple Sequence Alignment. An alignment of heads."

Similar presentations


Ads by Google