1. A brief on: Domain Families & Classification

2. The discovery of domains in protein structures Domains at the sequence level Examples of “Domain Resources” Domain fusion Supra-domains Signaling domains and cell function InterPro Evolution by Protein Domains

3. Classification to Families We can classify proteins into families by: –A. Sequence (motifs; proteins) –B. Structure –C. Function (annotation) –D. Evolution Automatic Large scale Automatic Large scale Manual High Quality Manual High Quality

4. Sequence Based Classification Proteins as a unit Proteins as combination of domains Functional Structural Sequence The Goal: 1.New Annotation, New Family, Family connections (sub/ super) … 2.Predicting power (given a new unknown sequence)

5. Protein Multiple Alignment (Structurally supported)

6. Q: What is the best way to ‘represent’ this low sequence similarity of ~ 70 aa Domains can be recognized through sequence similarity

7. Misannotation due to multidomain proteins Smith and Zhang. Nat Biotechnol 1997 15:1222-3 Domain of known function Domain of unknown function kinase Kinase-like A B A is similar to C, and C is similar to B, but A is not similar to B Multidomain protein C Annotation

8. Q: What is the best way to ‘represent’ this low sequence similarity of ~ 70 aa ‘ Profile’ PSSM Regular Expression HMM And more…

9. Multi domain protein families Impossible to find ‘evolutionary relatedness” without adding DOMAIN information…

10. Domains are the evolutionary units of sequence that comprise the gene coding regions. Most genes are built from more than one domain. Novel genes can be created by recombination of domains into new domain arrangements. How is a novel gene born?

11. Glycerone-P Glycerate-1,3P2 Glycerate-3P PGK1 GAPDH TIM Glyceraldehyde-3P Thermotoga Maritima PGK+TIM M. genitalium PGK M. genitalium TIM Phytophthora infestans TIM+GAPDH M. genitalium GAPDH From Glycolysis: Correspondence between functional associations and genes linked by the fusion method

12. 8e-78 2e-47 9e-41 1e-42 False Transitivity of Local Alignment CSKP HUMAN DLG3 MOUSEMPP3 HUMANK6A1 MOUSE BLAST values Pairwise similarities better than 1e-40 EScore If we cluster these proteins, assuming transitivity of local alignment scores, we will cluster K6A1_MOUSE with MPP3_HUMAN input

13. Used Terms: Motif = Domain = Signature = Profile = Seed Family = Cluster These terms are used interchangeably, They are very (too) flexible Domain Classification (intro to few systems)

14. Protein Sequence Domain Classification DOMO ADDA EVEREST InterPro CDD MetaFam ProSite Pfam Blocks+ Profile SBASE TigrFam eMotif SMART PRINTS ProDom Based on different principles and a different focus!

15. Integration: Data Fusion InterPro 13,000 entries Based on UniProt DB

16. Expert system Pfam InterPro - >13,000 entries 2006 >8000 Sequence coverage Pfam-A : 75% Sequence coverage Pfam-B : 19% Other

17. Examples: complexity in domains Identification ? Boundary ? Composition ? Examples: complexity in domains Identification ? Boundary ? Composition ?

18. Why domains and not proteins Reducing false transitivity. Exposing Mix and Match evolution Immediate relevance to structural domain-families Suggesting evolutionary ‘robust units’ Providing models for a family Why automatic? Overcoming large amounts of data Unbiased identification of new families (even without an identified seed / without 3D structural information )

19. Domains are the building blocks of evolution: some facts.. Pyruvate kinase, PDB:1pkn 3 domains Each occurs in diverse sets of protein families Number of domains in proteins ranges from 1 up to tens Structural based domain are ~ 150 aa Length varies: some are very short 30-40 aa, other are long > 500 aa Domain definition is somewhat blurred Domain boundary is an unsolved problem

20. What is a domain? You know it when you see one

21. Automatic vs Manual >13,000 entries

22. General approaches Motif based databases Prosite, Prints, Blocks, eMotif, InterPro Domain-based databases Pfam, ProDom, Domo, Smart Manual/Semi-manual Prosite Semi-automatically Pfam, Smart Fully automatic ProDom, Blocks, Domo, eMotif Use different models (regular expressions, profiles, HMMs) Based on each other

23. Example of semi - automatic Pfam: Nucleic Acids Research, 2007, 1–8 1.Release of Pfam (22.0) contains 9318 protein families. cover 73.2% of sequences and 50.8%. 2.Pfam is now based on UniProtKB, NCBI GenPept and metagenomics projects. 3. ~ 500 new Pfam-A families for PDB sequences and SCOP entries. Increasing the aa cover ! 4. Clans are built manually (supported by literature, SCOP..) total of 283 clans comprising a total of 1808 Pfam-A families.

24. The Power of Integration Pfam, Prosite, SMART, PRINTS, tigrFam ProDom InterPro SCOP CATH FSSP GO ENZ KEGG

25. TRANSFERASE (METHYLTRANSFERASE) 1adm Proteins were found to have spatially distinct structural units Structure Domains provide a “clean” definition

26. In 1974, Michael Rossman observes that structural domains can recur in different structural contexts 1ht0 – an alcohol dehydrogenase 1i0z – a lactate dehydrogenase Rossman fold

27. Domains can recur in multiple copies in the same protein Fibronectin protein–1fnf

28. A distinct, compact, and stable protein structural unit that folds independently of other such units. Structural definition of domains

29. A distinct, compact, and stable protein structural unit that folds independently of other such units. Structural definition of domains

30. Recurrent domains in diphtheria toxin (1ddt) The diphtheria toxin is made up of three domains, each of which is involved in a different stage of infection (receptor binding, membrane penetration, and catalysis of ADP-ribosylation of elongation factor 2). A structural neighbor is depicted next to each domain of diphtheria toxin (middle).

31. Dominant domain fold types. Holm and Sander. PROTEINS: Structure, Function, and Genetics 33:88–96 (1998)

32. 701 1,110 1,940 44,327 SCOP – a structural classification of proteins Updated from Murzin et al. J. Mol. Biol. 247, 536-540. Families are in turn grouped into superfamilies where sequence similarity is still recognizable and basic biochemical properties are conserved. Superfamilies and families are monophyletic (derive from a common ancestor)

33. Dominant domain fold types. Holm and Sander. PROTEINS: Structure, Function, and Genetics 33:88–96 (1998)

34. Sequence Biology predominantly proceeds by decomposing proteins into their domains Protein sequence families are constructed at the domain level

35. Prosite A dictionary of functional and structural motifs and domains Valuable biological information on each family Each motif/domain/family is represented as a regular expression, a rule or a profile Models are generated from (usually published) multiple alignments, manually calibrated to ensure selectivity and sensitivity Patterns do not always cover complete domains whereas profiles usually span the whole domain As of June 2002 contains 1800 patterns and profiles describing 1200 families or domains G-x(2,3)-[MLIV]-x-P-{K,H}-x(2)-C 1 2 3 4 5 6 7 8 9 10 11 A 0 0.25 0.25 1 0.5 0 1 0.5 0 0.25 0 C 0 0 0.25 0 0 0 0 0 0.25 0.25 1 G 1 0.5 0 0 0 0.25 0 0.5 0.75 0.25 0 T 0 0.25 0.5 0 0.5 0.75 0 0 0 0.25 0 OR

36. From the SMART database Detecting domains at the sequence level

37. Fusion link Glycyl-tRNA Synthetase E. Coli: CT796 Fusion Links glyQglyS C. Trachomatis: The fact that glyQ and glyS interact could have been predicted from the fusion protein CT796

38. Interpro An integrated resource of protein sites and functional domains The good thing about standards is that there are so many of them to choose from…

39. Introducing Interpro…. http://www.ebi.ac.uk/interpro/

40. Interpro entry for a zinc finger domain

41. חיפוש לפי taxonomy:

42. תוצאות חיפוש לדוגמא עבור החלבון 1Sirt באדם :

43. הצגת Alignment.

44. הצגת HMM-Logo.

45. iPfam - מאגר אינטראקציות domain-domain המבוסס על רשומות PDB.

46. יתרונות בולטים : קישור ממאגרי המידע המובילים – UniProt,PDB,interPro. בקרה ידנית על החלוקה למשפחות. חיפוש בעזרת HMM עבור רצפים גלובלים ומקומיים. ריכוז של domain architectures בהם משולב החלבון. עצים פילוגנטיים וטקסונומיים לחיפוש חלבונים הומולוגים מוכרים. תצוגת HMM ו -Alignment בצורה גרפית. אפשרות להוריד את המאגר בשלמותו.

47. Super-families of domains in Interpro (analogous to superfamilies in SCOP)

48. Some domains actually contain other domains!

49. GATCTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAGG TACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGGTGCAA TGGGAAGCTCTTCTGGAGAGTGAGAGAAGCTTCCAGTTAAGGTGACATTGAAGCCAAGTCCT GAAAGATGAGGAAGAGTTGTATGAGAGTGGGGAGGGAAGGGGGAGGTGGAGGGATGGGGAA TGGGCCGGGATGGGATAGCGCAAACTGCCCGGGAAGGGAAACCAGCACTGTACAGACCTGA ACAACGAAGATGGCATATTTTGTTCAGGGAATGGTGAATTAAGTGTGGCAGGAATGCTTTGTA GACACAGTAATTTGCTTGTATGGAATTTTGCCTGAGAGACCTCATTGCAGTTTCTGATTTTTTGA TGTCTTCATCCATCACTGTCCTTGATGGCATATTTTGTTCAGGGAATGGTGAATTAAGTGTGGC AGGAATGCTTTGTAGACACAGTAATTTGCTTGTATGGAGTCAAATAGTTTGGAACAGGTATAAT GATCACAATAACCCCAAGCATAATATTTCGTTAATTCTCACAGAATCACATATAGGTGCCACAGT TATGGAGT SignalingandMulticellularity AAACCTTAGGAATAATGAATGATTTGCGCAGGC TCACCTGGATATTAAGACTGAGTCAAATGTTGGGTCTGGTCTGACTTTAATGTTTGCTTTGTTC ATGAGCACCACATATTGCCTCTCCTATGCAGTTAAGCAGGTAGGTGACAGAAAAGCCCATGTT TGTCTCTACTCACACACTTCCGACTGAATGTATGTATGGAGTTTCTACACCAGATTCTTCAGTG CTCTGGATATTAACTGGGTATCCCATGACTTTATTCTGACACTACCTGGACCTTGTCAAATAGTT TGGACCTTGTCAAATAGTTTGGAGTCCTTGTCAAATAGTTTGGGGTTAGCACAGACCCCACAA GTTAGGGGCTCAGTCCCACGAGGCCATCCTCACTTCAGATGACAATGGCAAGTCCTAAGTTGT CACCATACTTTTGACCAACCTGTTACCAATCGGGGGTTCCCGTAACTGTCTTCTTGGGTTTAAT AATTTGCTAGAACAGTTTACGGAACTCAGAAAAACAGTTTATTTTCTTTTTTTCTGAGAGAGA GGGTCTTATTTTGTTGCCCAGGCTGGTGTGCAATGGTGCAGTCATAGCTCATTGCAGCCTTGAT TGTCTGGGTTCCAGTGGTTCTCCCACCTCAGCCTCCCTAGTAGCTGAGACTACATGCCTGCAC CACCACATCTGGCTAGTTTCTTTTATTTTTTGTATAGATGGGGTCTTGTTGTGTTGGCCAGGCTG GCCACAAATTCCTGGTCTCAAGTGATCCTCCCACCTCAGCCTCTGAAAGTGCTGGGATTACAG ATGTGAGCCACCACATCTGGCCAGTTCATTTCCTATTACTGGTTCATTGTGAAGGATACATCTC AGAAACAGTCAATGAAAGAGACGTGCATGCTGGATGCAGTGGCTCATGCCTGTAATCTCAGCA CTTTGGGAGGCCAAGGTGGGAGGATCGCTTAAACTCAGGAGTTTGAGACCAGCCTGGGCAAC ATGGTGAAAACCTGTCTCTATAAAAAATTAAAAAATAATAATAATAACTGGTGTGGTGTTGTGC ACCTAGAGTTCCAACTACTAGGGAAGCTGAGATGAGAGGATACCTTGAGCTGGGGACTGGGG AGGCTTAGGTTACAGTAAGCTGAGATTGTGCCACTGCACTCCAGCTTGGACAAAAGAGCCTG ATCCTGTCTCAAAAAAAAGAAAGATACCCAGGGTCCACAGGCACAGCTCCATCGTTACAATG GCCTCTTTAGACCCAGCTCCTGCCTCCCAGCCTTCT One of the key problems of becoming a multicellular organism is solving the problem of cell signaling.

50. inactiveactiveinactive p kinase phosphotase Phosphorylation can reversibly alter the activity of an enzyme through the combined action of a protein kinase and a protein phosphatase. signal transduction

51. Tyrosine phosphorylation is a major mechanism of transmembrane signaling. Pawson and Scott. Scientific American (2000) Protein tyrosine kinases (PTKs) add phosphate to tyrosines

52. SH2 domains (Src-homlogy 2) SH2 domains are modules of ~100 amino acids that bind to specific phospho (pY)-containing peptide motifs The Pawson Lab http://www.mshri.on.ca/pawson/domains.html

53. Pawson, T. et al., Trends in Cell Biology Vol.11 No.12 December 2001 The SH2 domain is found embedded in a wide variety of metazoan proteins that regulate functionally diverse processes.

54. Several modular domains have been identified that recognize specific sequences on their target acceptor proteins. Protein modules for the assembly of signaling complexes Pawson & Scott. Science (1997) 278 2075-2080

55. One way receptors may amplify their signaling is to use adaptor proteins that provide additional docking sites for modular signaling proteins. Adaptor proteins

56. The Order of Domains in the Polypeptide Chains of Src and Abl, and Diagrams of Their Assembled, Autoinhibited States In both cases, the SH3-SH2 clamp fixes the bilobed kinase domain in an inactive conformation. The domain color codes are SH3, yellow; SH2, green; kinase small lobe, dark blue; kinase large lobe, light blue. The activation loop in the large lobe is red. Connector, linker, and N- and C-terminal extensions are black. In Bcr/Abl, gene fusion has replaced the Abl cap by a long segment of Bcr. Harrison, S. C. (2003). Cell, 112, 737–740. Supra-domains in Src and Abl

57. A supra-domain is defined as a domain combination in a particular N- to-C-terminal orientation that occurs in at least two different domain architectures in different proteins with: (i) different types of domains at the N and C-terminal end of the combination; or (ii) different types of domains at one end and no domain at the other. Supra-domains Evolutionary units larger than single domains Vogel C. J Mol Biol. 2004 336 (3) :809-23 N-terminal end C-terminal end Each represents a different domain architecture Supra-domain of size 2 and 3

58. Chothia C. Science 2003 300: 1701-1703 Vogel C. J Mol Biol. 2004 336 (3) :809-23 Supra-domains Evolutionary units larger than single domains The P-loop containing nucleotide triphosphate (NTP) hydrolase domain and the translation protein domain occur as one combination in several different translation factors. This supra-domain occurs in 35 different domain architectures, and five of these are given here.

59. The building blocks: modular interaction domains in signal transduction Pawson & Nash. Science (2003) 300 445-452

60. The Order of Domains in the Polypeptide Chains of Src and Abl, and Diagrams of Their Assembled, Autoinhibited States In both cases, the SH3-SH2 clamp fixes the bilobed kinase domain in an inactive conformation. The domain color codes are SH3, yellow; SH2, green; kinase small lobe, dark blue; kinase large lobe, light blue. The activation loop in the large lobe is red. Connector, linker, and N- and C-terminal extensions are black. In Bcr/Abl, gene fusion has replaced the Abl cap by a long segment of Bcr. Supra-domains in Src and Abl