1. Mass Spectrometry Separation principle: A particle with a certain mass (m) and a certain charge (z) behaves in a predictable manner when exposed to a electromagnetic (EM) field. By measuring this response, the ratio of the two variables (m/z) can be determined. First approach: Ionize the particle Accelerate the particle by an electric field Modify the flight-path of the particle with a magnetic field Measure the effect of the magnetic field

2. The First Mass Spectrometer: The Magnetic Sector chamber of ionized particles Acceleration magnet Atmospheric pressure Vacuum Photographic plate (m/z) 1 (m/z) 2 (m/z) 3

3. Other Types of Mass Spectrometers Quadropole only ions of known m/z can pass through at a given EM field generated by four poles (quadropole). Ion Trap only ions of known m/z can reach the detector, others are kept spinning in circles by an EM field generated by four poles. Time of Flight the accelerated ions travel a known length and the time it takes is directly related to the m/z ratio. Ion Cyclotron (Fourier Transform) similar to Ion Trap, six poles instead of four, the decay of the induced electric current of all the spinning ions is measured and transformed to frequency distribution, which is directly related to the m/z ratio.

4. Time of Flight Mass Spectrometer ionized particles acceleration Field free regiondetector Time  m/z Intensity Can only be performed in high vacuum to minimize collisions between ions of different mass or other gaseous moyeties Vacuum Atmospheric pressure

5. Matrix Assisted Laser Desorption Ionization produces mainly singly charged ions pulsed ionization, perfect match to TOF MS a “soft” ionization, good for sensitive biomolecules fairly tolerant of impurities such as salts and detergents laser sample gaseous plume + + + + + + - - - - - - - - - - - - - + + + + + + charge formation laser ablation

6. Sample Clean-Up

7. Ethanol Precipitation

8. GenoPure

9. ZipTip non-autoclaved water

10. Single Base Extension Primer ddC ddT ddA ddG 273.3 288.2 297.2 313.2 15 16 9 m/z

11. Single Base Extension Primer W1156 (22mer) TGCTATACCAAGTTTCCATAAA A A C T A T A C C A C/A

12. W1156 Sample 709C ΔM=312.7 Da

13. W1156 Sample 712C ΔM 1 =313.0 Da ΔM 2 =297.1 Da

14. W1156 Sample 713C ΔM=296.5 Da

15. W1156 Control (no DNA) ΔM=301.3 Da

16. Results of primer W1156 From FP experiments: 709C – Homozygote, type B (ddG) 712C – Heterozygote 713C – Homozygote, type A (ddA) Mass difference error compared to theoretical masses: (ΔM meas - ΔM ddNTP )/ ΔM ddNTP

17. Primer W1488 (34mer)

18. W1488 Sample 713C ΔM=296 Da