Download presentation
Presentation is loading. Please wait.
1
Signal Processing Problems in Genomics Mohammad Al Bataineh Illinois Institute of Technology Chicago, IL
2
Why is genomics interesting for the signal processing person? Because there are sequences there! OK, what sort of sequences? 1. Sequences from an alphabet of size four: … ATTCGAAGATTTCAACGGGAAAA … DNA 2. Sequences from an alphabet of size twenty: AACWYDEFGHIKLMNPQRSTVAPPQR Protein
3
Size-4 alphabet: A, C, T, G: bases (also called or nucleotides) DNA sequences (genomes) are made of these. Genes are parts of DNA, and are 4-letter sequences. Adenine Thymine Cytosine Guanine or Uracil (in RNA) DNA: deoxyribonucleic acid RNA:ribonucleic acid
Similar presentations
© 2024 SlidePlayer.com. Inc.
All rights reserved.