Presentation is loading. Please wait.

Presentation is loading. Please wait.

Signal Processing Problems in Genomics Mohammad Al Bataineh Illinois Institute of Technology Chicago, IL.

Published by Modified over 9 years ago

Similar presentations

Presentation on theme: "Signal Processing Problems in Genomics Mohammad Al Bataineh Illinois Institute of Technology Chicago, IL."— Presentation transcript:

1 Signal Processing Problems in Genomics Mohammad Al Bataineh Illinois Institute of Technology Chicago, IL

2 Why is genomics interesting for the signal processing person? Because there are sequences there! OK, what sort of sequences? 1. Sequences from an alphabet of size four: … ATTCGAAGATTTCAACGGGAAAA … DNA 2. Sequences from an alphabet of size twenty: AACWYDEFGHIKLMNPQRSTVAPPQR Protein

3 Size-4 alphabet: A, C, T, G: bases (also called or nucleotides) DNA sequences (genomes) are made of these. Genes are parts of DNA, and are 4-letter sequences. Adenine Thymine Cytosine Guanine or Uracil (in RNA) DNA: deoxyribonucleic acid RNA:ribonucleic acid

4

5

Download ppt "Signal Processing Problems in Genomics Mohammad Al Bataineh Illinois Institute of Technology Chicago, IL."

Similar presentations

Nucleic Acids The amino acid sequence of a polypeptide is programmed by genes. Genes consist of DNA, which is a polymer belonging to the class of compounds.

Nucleic Acids The amino acid sequence of a polypeptide is programmed by genes. Genes consist of DNA, which is a polymer belonging to the class of compounds.
Nucleic Acids Nucleic Acid Basics Contain instructions to build proteins 2 types: – DNA – RNA Composed of smaller units called nucleotides – Monomer:

Nucleic Acids Nucleic Acid Basics Contain instructions to build proteins 2 types: – DNA – RNA Composed of smaller units called nucleotides – Monomer:
Nucleic Acids.

Nucleic Acids.
BIOLOGICALLY IMPORTANT MACROMOLECULES NUCLEIC ACIDS.

BIOLOGICALLY IMPORTANT MACROMOLECULES NUCLEIC ACIDS.
Biochemistry Part IV Nucleic Acids. Largest organic molecule made by organisms Largest organic molecule made by organisms Include 2 main types: Include.

Biochemistry Part IV Nucleic Acids. Largest organic molecule made by organisms Largest organic molecule made by organisms Include 2 main types: Include.
Molecular Biology Background. Schematic view of DNA organization in a cell.

Molecular Biology Background. Schematic view of DNA organization in a cell.
Nucleic Acids DNA vs. RNA

Nucleic Acids DNA vs. RNA
Nucleic Acids Nucleic Acid Basics Contain instructions to build proteins 2 types: – DNA – RNA Composed of smaller units called nucleotides – Monomer:

Nucleic Acids Nucleic Acid Basics Contain instructions to build proteins 2 types: – DNA – RNA Composed of smaller units called nucleotides – Monomer:
DNA and now RNA DNA is deoxyriboneucleic acid. RNA is ribonucleic acid.

DNA and now RNA DNA is deoxyriboneucleic acid. RNA is ribonucleic acid.
Chapter 6 Genes and Gene Technology

Chapter 6 Genes and Gene Technology
DNA. Nucleic Acids Informational polymers Made of C,H,O,N and P No general formula Examples: DNA and RNA.

DNA. Nucleic Acids Informational polymers Made of C,H,O,N and P No general formula Examples: DNA and RNA.
Date DNA. ✤ DNA stands for deoxyribonucleic acid ✤ DNA carries all the genetic information of living organisms.

Date DNA. ✤ DNA stands for deoxyribonucleic acid ✤ DNA carries all the genetic information of living organisms.
DNA Bases. Adenine: Adenine: (A) pairs with Thymine (T) only.

DNA Bases. Adenine: Adenine: (A) pairs with Thymine (T) only.
D. NUCLEIC ACIDS 1.ARE MADE OF THE ELEMENTS C,H,O,N,P.

D. NUCLEIC ACIDS 1.ARE MADE OF THE ELEMENTS C,H,O,N,P.
DNA holds the instructions When proteins are produced in the body, the instructions for how to make it comes from the DNA (deoxyribonucleic acid) BUT,

DNA holds the instructions When proteins are produced in the body, the instructions for how to make it comes from the DNA (deoxyribonucleic acid) BUT,
DNA Deoxyribose Nucleic Acid. DNA (deoxyribonucleic acid) Genetic Information in the form of DNA is passed from parent to offspring. Genes are the code.

DNA Deoxyribose Nucleic Acid. DNA (deoxyribonucleic acid) Genetic Information in the form of DNA is passed from parent to offspring. Genes are the code.
Protein Synthesis Worksheet Packet

Protein Synthesis Worksheet Packet
DNA structure.

DNA structure.
Nucleic Acids.

Nucleic Acids.
Regents Biology Nucleic Acids Information storage.

Regents Biology Nucleic Acids Information storage.

Similar presentations

Ads by Google