1. Genomes

2. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all enzymes, cellular structures & activitiesmaster blueprints for all enzymes, cellular structures & activities An organism‘s complete set of DNA An organism‘s complete set of DNA All the DNA contained in the cell of an organism All the DNA contained in the cell of an organism The collection of DNA that comprises an organism. Total genetic information carried by a single set of chromosomes in a haploid nucleus Total genetic information carried by a single set of chromosomes in a haploid nucleus

3. Genome sequencing chronology YearOrganismSignificance Genome size (bp) Number of genes 1977 Bacteriophage fX174 First genome5,38611 1981 Human mitochondria First organelle16,50037 1995 Haemophilus influenzae Rd First free- living organism 1,830,137~3,500 1996 Saccharomyces cerevisiae First eukaryote 12,086,000~6,000

4. Genome sequencing chronology YearOrganismSignificance Genome size (bp) Number of genes 1998 Caenorhab-ditis elegans First multi- cellular organism 97,000,000~19,000 1999 Human chromosome 22 First human chromosome 49,000,000673 2000 Drosophila melanogaster First insect150,000,000~14,000 2000 Arabidopsis thaliana First plant genome 150,000,000~25,000

5. Genome size

6. Virus A subcellular parasite with genes of DNA or RNA and which replicates inside the host cell upon which it relies for energy and protein synthesis. In addition, it has an extra- cellular form in which the virus genes are contained inside a protective coat

7. The Baltimore classification system Based on genetic contents and replication strategies of viruses. According to the Baltimore classification, viruses are divided into the following seven classes: 1. dsDNA viruses 2. ssDNA viruses 3. dsRNA viruses 4. (+) sense ssRNA viruses (codes directly for protein) 5. (-) sense ssRNA viruses 6. RNA reverse transcribing viruses 7. DNA reverse transcribing viruses "ds" represents "double strand" and "ss" denotes "single strand".

8. Plant DNA viruses are rare Cauliflower mosaic virus Spherical, kills Cauliflower and Brussel Sprouts Most plant viruses are small and comprised of ssRNA   Rod shaped, attacks tomato, pepper, beets, turnips, tobacco   2,130 identical proteins surround the ssRNA   ~10,000bp, ~10 genes Plant Viroids Plant Viruses

9. Highly complementary circular ssRNA No protein coat Smaller than viruses (few hundreds of bases) Smallest known virus is 3.2 kbp in size RNA does not code for any known protein Some even lack the AUG initiation codon Replication mechanism is unknown Viroids cannot recognize and infect host cell Relies on cells being weak or injured Proposed that viroids are "escaped introns" Viroids are usually transmitted by seed or pollen Infected plants can show distorted growth The first viroid to be identified was the Potato spindle tuber viroid (PSTVd) Some 33 species have been identified Plant Viroids

10. Procaryotic genomes Generally 1 circular chromosome (dsDNA) Usually without introns Relatively high gene density (~2500 genes per mm of E. coli DNA) Often indigenous plasmids are present 1.Eschericia coli 2.Agrobacterium tumefaciens

11. Eschericia coli It is a free living, gram negative bacterium It is a normal resident of the large intestine in healthy people It grows best with incubation at 37°C in a culture medium that approximates the nutrient available in the human digestive tract It is a type of probiotic organism because it crowds out disease causing bacteria. It also makes vitamin K which humans require to be healthy. Some strains make people sick. The toxic strains are responsible for about half of all cases of traveler's diarrhea.

12. Eschericia coli It replicates once every 22 minutes, giving rise to 30 generations and more than 1 billion cells in 11 hours It replicates once every 22 minutes, giving rise to 30 generations and more than 1 billion cells in 11 hours Its growth falls into several distinct phases (lag, logaritmic, stationary and death) Its growth falls into several distinct phases (lag, logaritmic, stationary and death) The individual cells are invisible to the naked eye, after plating onto solid medium, each cell divides to form a visible colony of identical daughter cells in 12-24 hours The individual cells are invisible to the naked eye, after plating onto solid medium, each cell divides to form a visible colony of identical daughter cells in 12-24 hours

13. Eschericia coli It provides a relatively simple and well understood genetic improvement in which to isolate foreign DNA Its primary genetic complement is contained on a single chromosome which locations and sequences of a large number of its genes are known The genetic code is nearly universal Under the best circumstances, the uptake of a specific foreign gene is a relatively rare occurrence and is thus most easily accomplished in a large populations that are reproducing rapidly

14. Eschericia Coli genome Single chromosome of approximately 5 million base pairs (5 Mbp) 4288 protein coding genes: Average ORF 317 amino acids Average gene size 1000 bp Very compact: average distance between genes 118bp Contour length of genome: 1.7 mm It can accept foreign DNA derived from any organism Some genes are arranged in the plasmid

15. Agrobacterium tumefaciens

16. Agrobacterium tumefaciens is a gram- negative soil phytopathogen Agrobacterium tumefaciens is a gram- negative soil phytopathogennon- sporing, motile, rod-shaped bacterium, closely related to Rhizobium which forms nitrogen-fixing nodules on clover and other leguminous plants. Agrobacterium affect most dicotyledonous plants in nature, resulting in crown gall tumors at the soil-air junction upon tissue wounding Agrobacterium affect most dicotyledonous plants in nature, resulting in crown gall tumors at the soil-air junction upon tissue wounding Agrobacterium has the broadest host range of any plant pathogenic bacterium

17. Agrobacterium tumefaciens Most of the genes involved in crown gall disease are not borne on the chromosome of A. tumefaciens but on a large plasmid, termed the Ti (tumour- inducing) plasmid. It is important to note that only a small part of the plasmid (the T-DNA) enters the plant; the rest of the plasmid remains in the bacterium to serve further roles. When integrated into the plant genome, the genes on the T-DNA code for: production of cytokinins production of indoleacetic acid synthesis and release of novel plant metabolites - the opines and agrocinopines.

18. Agrobacteria that causes neoplastic diseases in plants Agrobacterium rhizogenes (hairy root disease). Agrobacterium rhizogenes (hairy root disease). Agrobacterium rubi (cane gall disease) Agrobacterium rubi (cane gall disease) Agrobacterium tumefaciens (crown gall disease) Agrobacterium tumefaciens (crown gall disease) Agrobacterium vitis (crown gall of grape ) Agrobacterium vitis (crown gall of grape )

19. What will Agrobacterium tumefaciens affect in plants? Crown gall disease is not generally fatal, but it will reduce plant vigor and crop yield, and crown galls will attract other phytopathogens or pests. Crown gall disease is not generally fatal, but it will reduce plant vigor and crop yield, and crown galls will attract other phytopathogens or pests. In some cases, necrosis or apoptosis is observed after Agrobacterium infection. In some cases, necrosis or apoptosis is observed after Agrobacterium infection.

20. The discovery of Agrobacterium In 1897, Fridiano Cavara identified a flagellate, bacilloid bacterium as a casual agent of crown gall of grape. In 1897, Fridiano Cavara identified a flagellate, bacilloid bacterium as a casual agent of crown gall of grape. This organism is Agrobacterium vitis, causing the growth of neoplastic tumors on the stem and crown of grapevines and inducing necrotic lesions on grape roots. This organism is Agrobacterium vitis, causing the growth of neoplastic tumors on the stem and crown of grapevines and inducing necrotic lesions on grape roots.

21. Historical discoveries about agrobacterium Turn of 20 th century – found causes crown gall disease Turn of 20 th century – found causes crown gall disease 1940’s – crown gall tissue cultured due to hormone autotrophy 1940’s – crown gall tissue cultured due to hormone autotrophy 1970’s – pathogenicity transferred between bacteria via conjugation – evidence of plasmid involvement 1970’s – pathogenicity transferred between bacteria via conjugation – evidence of plasmid involvement 1980’s T-DNA was first engineered to carry useful genes into plants using methods that ‘hijacked’ the natural process 1980’s T-DNA was first engineered to carry useful genes into plants using methods that ‘hijacked’ the natural process

22. Evidence for plasmid involvement in the virulence of agrobacterium 1. 1.Relationship between virulence and specific plasmids in different agrobacterium strains 2. 2.Loss of virulence with loss of plasmids when grown at high temp (plus restoration of virulence when same plasmids replaced) 3. 3.Virulence transferred when plasmids transferred between virulent and non-virulent strains 4. 4.Stable nature of hormone autotrophy in infected host plant tissues indicated that this was genetically determined and could result from genetic transfers between agrobacterium and its host 5. 5.Fragments of agrobacterium plasmids (T-DNA) were found in the DNA of diseased tissues 6.Plants regenerated from diseased tissues were bred to produce offspring which inherited the T-DNA in a Mendelian manner. 7.This indicated that the T-DNA was integrated into nuclear DNA

23. Autoradiogram of a Southern blot of DNA extracted from cured crown gall cells probed with T-DNA showing the presence of T-DNA within the plant genome. Lanes 1 & 2: T-DNA extracted from agrobacterium Ti plasmid Lanes 3, 5 & 6: DNA extracted from gall cells Lane 4: DNA from non-infected plant tissue

24. Agrobacterium lives in intercellular spaces of the plant

25. Steps of Agrobacterium-plant cell interaction 1. 1.Cell-cell recognition 2. 2.Signal transduction and transcriptional activation of vir genes 3. 3.Conjugal DNA metabolism 4. 4.Intercellular transport 5. 5.Nuclear import 6. 6.T-DNA integration

26. Agrobacterium tumefaciens genome Genome size (chromosome) is aboutGenome size (chromosome) is about 6 Mb A large (~250kbp) plasmid called Tumor-inducing (Ti) plasmid)A large (~250kbp) plasmid called Tumor-inducing (Ti) plasmid) Plasmid contains genes responsible for the diseasePlasmid contains genes responsible for the disease Portion of the Ti plasmid is transferred between bacterial cells and plant cells  T-DNA (Transfer DNA)Portion of the Ti plasmid is transferred between bacterial cells and plant cells  T-DNA (Transfer DNA) T-DNA integrates stably into plant genomeT-DNA integrates stably into plant genome Single stranded T-DNA fragment is converted to dsDNA fragment by plant cellSingle stranded T-DNA fragment is converted to dsDNA fragment by plant cell Then integrated into plant genome Then integrated into plant genome 2 x 23bp direct repeats play an important role in the excision and integration process 2 x 23bp direct repeats play an important role in the excision and integration process

27. Agrobacterium tumefaciens What is naturally encoded in T-DNA? What is naturally encoded in T-DNA? Enzymes for auxin and cytokinin synthesisEnzymes for auxin and cytokinin synthesis Causing hormone imbalance  tumor formation/undifferentiated callus Causing hormone imbalance  tumor formation/undifferentiated callus Mutants in enzymes have been characterized Mutants in enzymes have been characterized Opine synthesis genes (e.g. octopine or nopaline)Opine synthesis genes (e.g. octopine or nopaline) Carbon and nitrogen source for A. tumefaciens growth Carbon and nitrogen source for A. tumefaciens growth Insertion genes Insertion genes Virulence (vir) genesVirulence (vir) genes Allow excision and integration into plant genomeAllow excision and integration into plant genome

28. Plasmids Naturally Extra chromosomal circular DNAs They exist separate from the main chromosome They replicate within the host cells Their size vary form ~ 1,000 to 250,000 base pairs They can be divided into two broad groups according to how tightly their replication in regulated: 1. stringent plasmids (low copy number plasmids: 1-2 plasmids/cell) only replicate along with the main bacterial chromosome and so exist as single copy, or at most several copies within the cell 2. Relaxed plasmid (multi copy number plasmids) replicate autonomously of the main chromosome and have copy numbers of 10 - 500 per cells

29. pBR322 The plasmid pBR322 is one of the most commonly used E.coli cloning vectors. pBR322 is 4361 bp in length and contains: (1) the replicon rep responsible for the replication of plasmid (source – plasmid pMB1); (2) rop gene coding for the Rop protein, which promotes conversion of the unstable RNA I – RNA II complex to a stable complex and serves to decrease copy number (source – plasmid pMB1); (3) bla gene, coding for beta-lactamase that confers resistance to ampicillin (source – transposon Tn3); (4) tet gene, encoding tetracycline resistance protein (source – plasmid pSC101).

30. Genetic structure of the Ti plasmid TLTL T R Aux Cyt Opines Oncogenes

31. Left Border and Right Border (Tumor-inducing) transfer

32. Ti plasmid of A. tumefaciens

33. 1.Auxin, cytokinin, opine synthetic genes transferred to plant 2.Plant makes all 3 compounds 3.Auxins and cytokines cause gall formation 4.Opines provide unique carbon/nitrogen source only A. tumefaciens can use!

34. Saccharomyces cerevisiae Nonpathogenic Nonpathogenic Rapid growth (generation time ca. 80 min) Rapid growth (generation time ca. 80 min) Dispersed cells Dispersed cells Ease of replica plating and mutant isolation Ease of replica plating and mutant isolation Can be grown on defined media giving the investigator complete control over environmental parameters Can be grown on defined media giving the investigator complete control over environmental parameters Well-defined genetic system Well-defined genetic system Highly versatile DNA transformation system Highly versatile DNA transformation system

35. Saccharomyces cerevisiae Strains have both a stable haploid and diploid state Strains have both a stable haploid and diploid state Viable with a large number of markers Viable with a large number of markers Recessive mutations are conveniently manifested in haploid strains and complementation tests can be carried out with diploid strains Recessive mutations are conveniently manifested in haploid strains and complementation tests can be carried out with diploid strains The ease of gene disruptions and single step gene replacements offers an outstanding advantage for experimentation The ease of gene disruptions and single step gene replacements offers an outstanding advantage for experimentation

36. Saccharomyces cerevisiae Yeast genes can functionally be expressed when fused to the green fluorescent protein (GFP) thus allowing to localize gene products in the living cell by fluorescence microscopy The yeast system has also proven an invaluable tool to clone and to maintain large segments of foreign DNA in yeast artificial chromosomes (YACs) being extremely useful for other genome projects and to search for protein-protein interactions using the two- hybrid approach Transformation can be carried out directly with short single-stranded synthetic oligonucleotides, permitting the convenient productions of numerous altered forms of proteins

37. Genome of diploid Saccharomyce cerevisiae cell Characteristic Chromosomes Plasmid Mitochondiral Relative amount (%)85510 Number of copies2 x 1660-100~50 (8-130) Size (kbp)14.000 6,318 70-76 Yeast genome

38. Yeast plasmid

39. The yeast genome S. cerevisiae contains a haploid set of 16 well-characterized chromosomes, ranging in size from 200 to 2,200 kb Total sequence of chromosomal DNA is 12,8 Mb 6,183 ORFs over 100 amino acids long First completely sequenced eukaryote genome Very compact genome: Short intergenic regionsShort intergenic regions Scarcity of intronsScarcity of introns Lack of repetitive sequencesLack of repetitive sequences Strong evidence of duplication: Chromosome segmentsChromosome segments Single genesSingle genes Redundancy: non-essential genes provide selective advantage Redundancy: non-essential genes provide selective advantage

40. Eucaryotic genomes Located on several chromosomes Located on several chromosomes Relatively low gene density (50 genes per mm of DNA in humans) Relatively low gene density (50 genes per mm of DNA in humans) Carry organellar genome Carry organellar genome

41. Plant genomes Plant contains three genomes Plant contains three genomes Genetic information is divided in the chromosome. Genetic information is divided in the chromosome. The size of genomes is species dependent The size of genomes is species dependent The difference in the size of genome is mainly due to a different number of identical sequence of various size arranged in sequence The difference in the size of genome is mainly due to a different number of identical sequence of various size arranged in sequence The gene for ribosomal RNAs occur as repetitive sequence and together with the genes for some transfer RNAs in several thousand of copies The gene for ribosomal RNAs occur as repetitive sequence and together with the genes for some transfer RNAs in several thousand of copies Structural genes are present in only a few copies, sometimes just single copy. Structural genes encoding for structurally and functionally related proteins often form a gene family Structural genes are present in only a few copies, sometimes just single copy. Structural genes encoding for structurally and functionally related proteins often form a gene family The DNA in the genome is replicated during the interphase of mitosis The DNA in the genome is replicated during the interphase of mitosis

43. Arabidopsis thaliana A weed growing at the roadside of central Europe A weed growing at the roadside of central Europe It has only 2 x 5 chromosomes It has only 2 x 5 chromosomes It is just 70 Mbp It is just 70 Mbp It has a life cycle of only 6 weeks It has a life cycle of only 6 weeks It contains 25,498 structural genes from 11,000 families It contains 25,498 structural genes from 11,000 families The structural genes are present in only few copies sometimes just one protein The structural genes are present in only few copies sometimes just one protein Structural genes encoding for structurally and functionally related proteins often form a gene family Structural genes encoding for structurally and functionally related proteins often form a gene family

44. Peculiarities of plant genomes Huge genomes reaching tens of billions of base pairs Huge genomes reaching tens of billions of base pairs Numerous polyploid forms Numerous polyploid forms Abundant (up to 99%) non coding DNA which seriously hinders sequencing, gene mapping and design of gene Abundant (up to 99%) non coding DNA which seriously hinders sequencing, gene mapping and design of gene Poor morphological, genetics, and physical mapping of chromosomes Poor morphological, genetics, and physical mapping of chromosomes A large number of “small-chromosome” in which the chromosome length does not exceed 3 μm A large number of “small-chromosome” in which the chromosome length does not exceed 3 μm The number of chromosomes and DNA content in many species is still unknown The number of chromosomes and DNA content in many species is still unknown

45. Size of the genome in plants and human Genome Arabidopsis thaliana Zea mays Vicia faba Human Nucleus 70 Millions 3900 Millions 14500 Millions 2800 Millions Plastid 0.156 Millions 0.136 Millions 0.120 Millions Mitochondrion 0.370 Millions.570 Millions.290 Millions.017 Millions

46. Organisation of the genome into chromosome The nuclear genome is organized into chromosome The nuclear genome is organized into chromosome Chromosomes consist of essentially one long DNA helix wound around nucleosome Chromosomes consist of essentially one long DNA helix wound around nucleosome At metaphase, when the genome is relatively inactive, the chromosome are most condensed and therefore most easily observed cytologically, counted or separated At metaphase, when the genome is relatively inactive, the chromosome are most condensed and therefore most easily observed cytologically, counted or separated Chromosomes provide the means by which the plant genome constituents are replicated and segregated regularly in mitosis and meiosis Chromosomes provide the means by which the plant genome constituents are replicated and segregated regularly in mitosis and meiosis Large genome segments are defined by their conserved order of constituent genes Large genome segments are defined by their conserved order of constituent genes

47. Genome composition 1.Heterochromatin Darkly staining portions of chromosomes, believed due to high degree of coiling Darkly staining portions of chromosomes, believed due to high degree of coiling Non-genic DNA Non-genic DNA a. Centromere ~ “middle” of Chromosomes ~ “middle” of Chromosomes spindle attachment sites spindle attachment sites b. Telomeres 1. ends of chromosome 2. important for the stability of chromosomes tips. 2. Euchromatin Lightly staining portion of chromosomes Lightly staining portion of chromosomes It represents most of the genomes It represents most of the genomes It contains most of genes. It contains most of genes.

48. Ploidy and chromosome number OrganismPloidy Chromosome number Corn Diploid (2X) 20 Tomato 24 Arabidopsis 10 Potato Tetraploid (4X) 48 Wheat Hexaploid (6X) 42

49. Organization of Plant Genome Protein coding gene Protein coding gene P Portion of genome which encodes for most of the transcribed genes (Protein coding genes) Non coding gene Non coding gene 1. Intron 2. 2. Regulatory elements of genes 3. Multiple copies of genes, including pseudogenes 4. Intergenic sequences 5. Interspersed repeats

50. Organization of Plant Genome Most plants contain quantities of DNA that greatly exceed their needs for coding and regulatory functions Very small percentage of the genome may encode for genes involved in protein production Based on kinetics: Low-copy-number DNA Low-copy-number DNA DNA sequences DNA sequences encodes for most of the transcribed genes (Protein coding genes) Medium-copy-number DNA Medium-copy-number DNA DNA sequences that encode ribosomal RNA (Tandemly repeated expressed DNA) High-copy-number DNA High-copy-number DNA I t is composed of highly repetitive sequences (Repetitious DNA)

51. Gene classification coding genes non-coding genes Messenger RNA Proteins Structural RNA Structural proteinsEnzymes transfer RNA ribosomal RNA other RNA Chromosome (simplified) intergenic region

52. Protein Coding Genes Segment of DNA which can be transcribed and translated to amino acid

53. Transcribed region ≈ Open Reading Frame (ORF) Transcribed region ≈ Open Reading Frame (ORF) long (usually >100 aa)long (usually >100 aa) “known” proteins  likely“known” proteins  likely Basal signals Basal signals Transcription, translationTranscription, translation Regulatory signals Regulatory signals Protein Coding Genes

54. Plant contains about 10 000 – 30 000 structural genes Plant contains about 10 000 – 30 000 structural genes They are present in only a few copies, sometimes just one (single copy gene) They are present in only a few copies, sometimes just one (single copy gene) They often form a gene family They often form a gene family The transcription of most structural genes is subject to very complex and specific regulation The transcription of most structural genes is subject to very complex and specific regulation The gene for enzymes of metabolism or protein biosynthesis which proceed in all cells are transcribed more often The gene for enzymes of metabolism or protein biosynthesis which proceed in all cells are transcribed more often Most of the genes are switched off and are activated only in certain organ and then often only in certain cells Most of the genes are switched off and are activated only in certain organ and then often only in certain cells Many genes are only switched on at specific times Many genes are only switched on at specific times House keeping gene: The genes which every cell needs for such basic functions independent of its specialization

55. What do the genes encode? Genes for basic cellular functions such as translation, transcription, replication and repair share similarity among all organisms Basic functions Yeast – simplest eukaryote Worm – programmed development Fly – complex development Arabidopsis – plant life cycle + Microbes highly specialized Gene families expand to meet biological needs.

56. Pseudogenes Nonfunctional copies of genes Formed by duplication of ancestral gene, or reverse transcription (and integration) Not expressed due to mutations that produce a stop codon (nonsense or frame-shift) or prevent mRNA processing, or due to lack of regulatory sequences

57. Tandemly Repeated DNA A large number of identical repeated DNA sequences A large number of identical repeated DNA sequences It spread over the entirely chromosome It spread over the entirely chromosome There is variation within species for the number of copies in allelic arrays There is variation within species for the number of copies in allelic arrays Variations in the lengths of tandemly repeat units have been used as a sources of molecular marker Variations in the lengths of tandemly repeat units have been used as a sources of molecular marker It is divided into: It is divided into: 1. Tandemly repeated expressed DNA 2. Tandemly repeated non expressed DNA (Repetitious DNA)

58. Tandemly Repeated Expressed Genes Genes which are duplicated and clustered at many location of the genome Genes which are duplicated and clustered at many location of the genome Ribosomal 18S, 58S, 25S and 5S RNA genes are highly reiterated in clusters and form at sites called nucleolus organizers (NOR) Ribosomal 18S, 58S, 25S and 5S RNA genes are highly reiterated in clusters and form at sites called nucleolus organizers (NOR) They are also observed for tDNA and histones They are also observed for tDNA and histones

59. Tandemly Repeat non expressed DNA Simple-sequence DNA Simple-sequence DNA Moderately repeated DNA (mobile DNA) Moderately repeated DNA (mobile DNA) Repetitive sequences which are unable to be expressed but found in huge amount in the genome

60. Simple Sequence DNA Very sort sequences repeated many times in tandem in large clusters It is also called as satellite DNA in centromeres and telomeres It often lies in heterochromatin especially in centromeres and telomeres It is divided into 2 groups: It is divided into 2 groups: Mini satellite : Variable number tandem repeat (VNTR) Micro satellite : Simple sequence repeat (SSR) It is used in DNA fingerprinting to identify individuals It is used in DNA fingerprinting to identify individuals

61. Tandemly repeated DNA Microsatellite (SSR: Simple sequence repeat) Microsatellite (SSR: Simple sequence repeat) Unit size: at most 5 bpUnit size: at most 5 bp ATATATATATATATATATATATATATATATATATATATATATATATAT Minisatellite Minisatellite Unit size: up to 25 bpUnit size: up to 25 bp ATTGCTGTATTGCTGTATTGCTGTATTGCTGTATTGCTGTATTGCTGT

62. Mobile DNA (Jumping gene) Move within genomes Most of moderately repeated DNA sequences found throughout higher eukaryotic genomes Some encode enzymes that catalyze movement 2 types: a. Transposon b. Retrotransposon Units of DNA which are predisposed to move to another location, sometimes involving replication of the unit, with the help of products of genes on the elements or on related element

63. Transposon DNA Involves copying of mobile DNA element and insertion into new site in genome Molecular parasite: “selfish DNA” Molecular parasite: “selfish DNA” They probably have significant effect on evolution by facilitating gene duplication, which provides the fuel for evolution, and exon shuffling They probably have significant effect on evolution by facilitating gene duplication, which provides the fuel for evolution, and exon shuffling

64. Retrotransposon (retroelement) Transposon like segment of DNA Transposon like segment of DNA Retroviruses lacking the sequence encoding the structural envelope protein Retroviruses lacking the sequence encoding the structural envelope protein Major component of plant genome Major component of plant genome Size ranges from 1 to 13 kb in length Size ranges from 1 to 13 kb in length Widely distributed over the chromosomes of many plant species gene Widely distributed over the chromosomes of many plant species gene Retrovirus A virus of higher organism whose genome is RNA, but which can insert a DNA copy its genome into host chromosome

65. 50-80% of plant genomes are Transposable Element Mobile elements

66. Plant genome sizes

67. Small difference in gene number, although rice genome is 3x the size Predicted Gene numbers

69. Peter J. Russell, iGenetics: Copyright © Pearson Education, Inc., publishing as Benjamin Cummings. Eukaryotic cells Eukaryotic cells

70. Mitochondrial genome (mtDNA) Number of mitochondria in plants can be between 50-2000 Number of mitochondria in plants can be between 50-2000 One mitochondria consists of 1 – 100 genomes (multiple identical circular chromosomes). One mitochondria consists of 1 – 100 genomes (multiple identical circular chromosomes). They are one large and several smaller They are one large and several smaller Size ~ 200 kb to 2,500 kb in plants Size ~ 200 kb to 2,500 kb in plants Mt DNA is replicated before or during mitosis Mt DNA is replicated before or during mitosis Transcription of mtDNA yielded an mRNA which did not contain the correct information for the protein to be synthesized. Transcription of mtDNA yielded an mRNA which did not contain the correct information for the protein to be synthesized. RNA editing is existed in plant mitochondria RNA editing is existed in plant mitochondria Over 95% of mitochondrial proteins are encoded in the nuclear genome. Over 95% of mitochondrial proteins are encoded in the nuclear genome. Often A+T rich genomes Often A+T rich genomes

71. Chloroplast genome (ctDNA) Multiple circular molecules, similar to procaryotic cyanobacteria, although much smaller (0.001-0.1%of the size of nuclear genomes) Multiple circular molecules, similar to procaryotic cyanobacteria, although much smaller (0.001-0.1%of the size of nuclear genomes) Cells contain many copies of plastids and each plastid contains many genome copies Cells contain many copies of plastids and each plastid contains many genome copies Size ranges from 120 kb to 160 kb Size ranges from 120 kb to 160 kb Plastid genome has changed very little during evolution. Though two plants are very distantly related, their genomes are rather similar in gene composition and arrangement Plastid genome has changed very little during evolution. Though two plants are very distantly related, their genomes are rather similar in gene composition and arrangement Some of plastid genomes contain introns Some of plastid genomes contain introns Many chloroplast proteins are encoded in the nucleus (separate signal sequence) Many chloroplast proteins are encoded in the nucleus (separate signal sequence)

72. DNA for chloroplast proteins can be come from the nucleus or chloroplast genome Buchannan et al. Fig. 4.4