2. Polyploidy …more than two haploid sets of chromosomes are present, –2n = diploid, –3n = triploid, –4n = tetraploid, –etc.

3. Autopolyploidy... polyploidy resulting from the replication of one or more sets of chromosomes, …the additional set of chromosomes is identical to the normal haploid complement of that species.

4. Autopolyploidy …can be induced by treating cells with the drug colchicine, â colchicine: is a alkaloid derivative from the autumn crocus (Crocus veneris),...inhibits microtubule polymerization, and thus inhibits the separation of chromosomes during meiosis.

5. Colchicine Treatment cells undergo S-phase, no separation of chromosomes is accomplished, no cell division occurs, at telophase, the nuclear membrane reforms, treatment for one cell cycle leads to 4n cells.

6. Amphidiploid …double diploid, 2n 1 + 2n 2 …have balanced gametes of the type n 1 + n 2, these gametes fuse to make fertile 2n 1 + 2n 2.

7. Autopolyploidy Applications Treating a plant with colchicine often produces autopolyploidy, resulting in plants with larger flowers and/or fruit, 8n8n2n2n 4n4n2n2n

8. Allopolyploidy Applications B. oleracea (cabbage, cauliflower, Brocolli, kale, etc.) 2n = 18 B. campestris (turnip, turnip rape) 2n = 20 n = 9 n = 10 amphidiploid n 1 + n 2 = 19B. napas ( Oil rape, canola oil) 2n 1 + 2n 2 = 38

9. 4n x 2n = 3n? The creation of triploids can be accomplished by crossing a tetraploid with a diploid, Most triploid individuals are sterile.

10. Generation of a Triploid Cells

11. Meiosis in a Triploid Organism

12. Who’d want to Eat That? Bananas, Seedless Watermelon, Most other seedless varieties, Some oysters.

13. Environmental Applications? grass carp (Ctenopharyngodon idella) Triploid grass carp prefer pondweeds, do not prefer plants such as cattail, water lily, etc.

14. Polyploidy Summary More than 2 whole sets of chromosomes, Autopolyploidy, –from the same genome, –naturally occurring, or induced, –often results in larger varieties, Allopolyploidy, –from different genomes, –naturally occurring, or induced, –often results in larger varieties, Autotriploids, –most often sterile –can produce beneficial traits.

15. Monoploidy …a haploid of a diploid is monoploid, …has one chromosome set.

16. Monoploid male wasps, bees and ants have only 1 haploid genome, –males develop from unfertilized eggs, gametes are formed by mitosis.

17. Monoploid Applications monoploid plants can be created by culturing pollen grains (n = 1), –the population of haploid organisms is then screened for favorable traits, –the plants are then treated with colchicine which generates a 2n plant homozygous for the favorable traits.

18. Chromosomal Mutations –chromosome number, –structure,

19. Chromosome Structure Changes in chromosome structure can come about due to, deletions duplications rearrangements

20. Chromosomal Deletions a deletion results in a lost portion of a chromosome,

21. Deletion Causative Agents heat, radiation, viruses, chemicals, errors in recombination.

22. Terminal Deletions Off the End

23. Intercalary Deletions From the Middle

24. Intercalary Deletions From the Middle

25. Recognizing Deletions Intercalary Terminal

26. Homologous Pairs? Intercalary Terminal Hemizygous Hemizygous: gene is present in a single dose. Psuedodominance: hemizygous genes are expressed.

27. Deletions …result in partial monosomy, â remember monosomy: 2n, -1, …the organism is monosomic for the portion of the chromosome that is deleted, …as in monosomy, most segmental deletions are deleterious.

28. Cri-du-chat Syndrome (46, -5p)

29. 46, -5p...terminal deletion of the small arm (petite arm) of chromosome 5, Cri-du-chat Syndrome, –0.002% live births, –anatomic mutations, –often mental retardation, –abnormal formation of vocal mechanisms.

30. Chromosomal Duplication...an event that results in the increase in the number of copies of a particular chromosomal region,

31. Duplication Cause and Effect Causes: –duplications often result from unequal crossing over, –can occur via errors in replication during S-Phase. Effects: –results in gene redundancy, –produces phenotypic variation, –may provide an important source for genetic variability during evolution.

32. Unequal Crossing Over Produces both duplications and deletions!

33. Duplication Phenotypes

34. Duplication in Evolution …essential genes do not tolerate mutation, …duplications of essential genes, then subsequent mutations, confers adaptive potential to the organism, …new gene family members are ‘recruited’ to perform new functions.

35. nutrients algae need uptake transport to other tissue transport to seeds moss need uptake flowering plant transport to other tissue need uptake

36. Arabidopsis

37. Chromosome Structure Changes in chromosome structure can come about due to, deletions duplications rearrangements

38. Chromosomal Inversions …inversion: aberration in which a portion of the chromosome is turned around 180 o.

39. Paracentric Inversion...an inversion in which the centomere is not included, ABC...a paracentric inversion does not change arm length ratio. BACBA

40. Inversion Heterozygotes …an organism with one wild-type and one chromosome containing an inversion, ABC …not heterozygous for the genes, heterozygous for the chromosomes. ABC

41. Inversion Loop no crossing over

42. Produces haploid gamete. Paracentric

43. Produces gamete with inversion. Paracentric

44. Produces a chromosome with two centromeres. Nonviable gametes. Paracentric

45. Dicentric...a chromosome having two centromeres;

46. Non-Viable (gametes) Segregate

47. Dicentric/Ascentric …results only when the crossing over occurs within the region of the paracentric inversion,

48. No centromeres. Deletions. Nonviable gametes. Paracentric

49. Acentric …a chromosome having no centromeres, …segregates to daughter cells randomly, or is lost during cell division, …deletions impart partial monosomy.

50. Paracentric Outcomes 1 Normal Gamete, 1 Inversion Gamete, No Crossover Classes Recombination is not inhibited, but recombinant gametes are selected against.

51. Pericentric Inversion...an inversion in which the centromere is included, ABCABC...a pericentric inversion results in a change in chromosome arm length.

52. Pericentric

53. Recombination and Inversions Paracentric and Pericentric; –1 Normal Gamete, – 1 Inverted Gamete, – No Crossover Classes = No Recombination, Inversions select against recombinant gametes, thus preserves co-segregation of specific alleles.

54. Inversions and Evolution Inversions ‘lock’ specific alleles together, –all offspring get the alleles from either a wild- type, or inverted chromosome, If the ‘set of alleles’ is advantageous, the set can be maintained in the population.

55. Assignment Understand the differences between ‘Interference’, and the suppression of recombination resulting from inversions, Be able to recognize data, and predict results given either case.

56. Translocations …translocation: aberration associated with the transfer of a chromosomal segment to a new location in the genome.

57. Synteny Description of DNA segments in which gene order is identical between species.

58. Terminal Translocation

59. Reciprocal Translocation

60. Robertsonian Translocations …the fusion of long arms of acrocentric chromosomes,

61. Down Syndrome 95% of Down Syndrome individuals are a result of Trisomy 21, –the probability of having a second Down Syndrome child is usually similar to the population at large, However, there is second cause of Down Syndrome caused by a Robertsonian translocations that is heritable.

62. Familial Down Syndrome

63. Assignment Do a Punnett Square or a Split Fork Diagram of, Parent 1: wild-type for Chromosomes 14, 21 x Parent 2: heterozygous for 14q;21q translocation.

64. Hint gametes

65. Trinucleotide Repeat Expansions FMR1 Fragile X Mental Retardation 1 cgg...GCGCGGCGGTGACGGAGGCGCCGC TGCCAGGGGGCGTGCGGCAGCG... …CTGGGCCTCGAAGCGCCCGCAGCCA cgg... > 200

67. Fragile Site Mutations

69. Assignment (think about these...) Truncated Genes; –genes that are no longer full length, due to a mutation, Gene Fusions; –genes that contain coding sequence from two different genes, resulting from a chromosomal mutation.

70. Review know genotypes and phenotypes, –trisomy, –monosomy, –inversions, –duplications, –deletions, –fragile site mutations, be able to predict heritability, and recognize data-sets and infer the condition.

71. Assigned Problems Chapter 5, 51 - 5.19 Quantitative Trait Loci Problems Online

72. Coming Up Wednesday; –Dosage Compensation (X-linked genes), –Questions and problems. Friday: Exam.