1. Role of IT in Bioinformatics Naveena.Y

2. What is bioinformatics ? Study of Information content and information flow in biological systems and processes Definition varies depending upon the domain of person who is giving the definition

3. What was the reason behind the emergence of a separate domain, bioinformatics ?

4. Brief History Insulin – 1956 Yeast trna – 1960’s PDB – 1972 Swissprot – 1986 Human Genome Initiated – 1988 Completed – 26 th Jun 2000

5. Where does the data come from? Wet Lab Research Database 1 Ex : Genbank Database 2 Ex : Swissprot Database 3 Ex : Interpro Publish Primary Secondary Composite

6. Central Dogma of Life

7. What is their in each of this? DNA – A,C,T,G RNA – A,C,U,G Protein – AUGACGAGAAGGAGUAGAAGUAG MV Codon Table

8. Protein Structure Primary Secondary Teritary Quarternary

9. IT is used in different areas Functional Genomics Proteomics Drug Discovery Plant Biotechnology Molecular Modeling

10. Challenges Protein Structure Prediction RNA Structure Preditction Drug Discovery Pharmacogenomics

11. Questions ?