Presentation is loading. Please wait.

Presentation is loading. Please wait.

What is bioinformatics? Finding patterns in molecular biological data Implies: managing molecular biological data identifying correlations in molecular.

Published by Modified over 9 years ago

Similar presentations

Presentation on theme: "What is bioinformatics? Finding patterns in molecular biological data Implies: managing molecular biological data identifying correlations in molecular."— Presentation transcript:

1 What is bioinformatics? Finding patterns in molecular biological data Implies: managing molecular biological data identifying correlations in molecular biological data Goals: characterise biological patterns & processes predict biological properties

2 Bioinformatics: neighbour disciplines Computational biology –Broader concept: includes computational ecology, physiology, neurology etc... -omics: –Genomics –Transcriptomics –Proteomics Systems biology –Putting it all together... –Building models, identify control & regulation

3 Bioinformatics: prerequisites Bio- side: –Molecular biology –Cell biology –Genetics –Evolutionary theory -informatics side: –Computer science –Statistics –Theoretical physics

4 Molecular biology data... >alpha-D ATGCTGACCGACTCTGACAAGAAGCTGGTCCTGCAGGTGTGGGAGAAGGTGATCCGCCAC CCAGACTGTGGAGCCGAGGCCCTGGAGAGGTGCGGGCTGAGCTTGGGGAAACCATGGGCA AGGGGGGCGACTGGGTGGGAGCCCTACAGGGCTGCTGGGGGTTGTTCGGCTGGGGGTCAG CACTGACCATCCCGCTCCCGCAGCTGTTCACCACCTACCCCCAGACCAAGACCTACTTCC CCCACTTCGACTTGCACCATGGCTCCGACCAGGTCCGCAACCACGGCAAGAAGGTGTTGG CCGCCTTGGGCAACGCTGTCAAGAGCCTGGGCAACCTCAGCCAAGCCCTGTCTGACCTCA GCGACCTGCATGCCTACAACCTGCGTGTCGACCCTGTCAACTTCAAGGCAGGCGGGGGAC GGGGGTCAGGGGCCGGGGAGTTGGGGGCCAGGGACCTGGTTGGGGATCCGGGGCCATGCC GGCGGTACTGAGCCCTGTTTTGCCTTGCAGCTGCTGGCGCAGTGCTTCCACGTGGTGCTG GCCACACACCTGGGCAACGACTACACCCCGGAGGCACATGCTGCCTTCGACAAGTTCCTG TCGGCTGTGTGCACCGTGCTGGCCGAGAAGTACAGATAA >alpha-A ATGGTGCTGTCTGCCAACGACAAGAGCAACGTGAAGGCCGTCTTCGGCAAAATCGGCGGC CAGGCCGGTGACTTGGGTGGTGAAGCCCTGGAGAGGTATGTGGTCATCCGTCATTACCCC ATCTCTTGTCTGTCTGTGACTCCATCCCATCTGCCCCCATACTCTCCCCATCCATAACTG TCCCTGTTCTATGTGGCCCTGGCTCTGTCTCATCTGTCCCCAACTGTCCCTGATTGCCTC TGTCCCCCAGGTTGTTCATCACCTACCCCCAGACCAAGACCTACTTCCCCCACTTCGACC TGTCACATGGCTCCGCTCAGATCAAGGGGCACGGCAAGAAGGTGGCGGAGGCACTGGTTG AGGCTGCCAACCACATCGATGACATCGCTGGTGCCCTCTCCAAGCTGAGCGACCTCCACG CCCAAAAGCTCCGTGTGGACCCCGTCAACTTCAAAGTGAGCATCTGGGAAGGGGTGACCA GTCTGGCTCCCCTCCTGCACACACCTCTGGCTACCCCCTCACCTCACCCCCTTGCTCACC ATCTCCTTTTGCCTTTCAGCTGCTGGGTCACTGCTTCCTGGTGGTCGTGGCCGTCCACTT CCCCTCTCTCCTGACCCCGGAGGTCCATGCTTCCCTGGACAAGTTCGTGTGTGCCGTGGG CACCGTCCTTACTGCCAAGTACCGTTAA DNA sequences

5 Molecular biology data... Amino acid sequences Protein structure: –X-ray crystallography –NMR

6 Cell biology & proteomics data... Subcellular localization

7 Cell biology & proteomics data... protein-protein interactions

8 DNA microarray technology Transcriptomics: DNA microarray technology

9 Proteomics & transcriptomics data Proteins encoded by periodically expressed genes: a functionally diverse protein category

10 Phenotype data: human diseases

Download ppt "What is bioinformatics? Finding patterns in molecular biological data Implies: managing molecular biological data identifying correlations in molecular."

Similar presentations

Martin John Bishop UK HGMP Resource Centre Hinxton Cambridge CB10 1 SB

Martin John Bishop UK HGMP Resource Centre Hinxton Cambridge CB10 1 SB
1 Inference of Regulatory Networks via Systems Genetics Ina Hoeschele.

1 Inference of Regulatory Networks via Systems Genetics Ina Hoeschele.
DNA as Biological Information Rasmus Wenersson. Overview Learning objectives –About Biological Information –A note about DNA sequencing techniques and.

DNA as Biological Information Rasmus Wenersson. Overview Learning objectives –About Biological Information –A note about DNA sequencing techniques and.
August 19, 2002Slide 1 Bioinformatics at Virginia Tech David Bevan (BCHM) Lenwood S. Heath (CS) Ruth Grene (PPWS) Layne Watson (CS) Chris North (CS) Naren.

August 19, 2002Slide 1 Bioinformatics at Virginia Tech David Bevan (BCHM) Lenwood S. Heath (CS) Ruth Grene (PPWS) Layne Watson (CS) Chris North (CS) Naren.
Bioinformatics at IU - Ketan Mane. Bioinformatics at IU What is Bioinformatics? Bioinformatics is the study of the inherent structure of biological information.

Bioinformatics at IU - Ketan Mane. Bioinformatics at IU What is Bioinformatics? Bioinformatics is the study of the inherent structure of biological information.
Bioinformatics Dr. Aladdin HamwiehKhalid Al-shamaa Abdulqader Jighly 2010-2011 Lecture 1 Introduction Aleppo University Faculty of technical engineering.

Bioinformatics Dr. Aladdin HamwiehKhalid Al-shamaa Abdulqader Jighly Lecture 1 Introduction Aleppo University Faculty of technical engineering.
Using Bioinformatics to Make the Bio- Math Connection The Confessions of a Biology Teacher.

Using Bioinformatics to Make the Bio- Math Connection The Confessions of a Biology Teacher.
Bioinformatics: a Multidisciplinary Challenge Ron Y. Pinter Dept. of Computer Science Technion March 12, 2003.

Bioinformatics: a Multidisciplinary Challenge Ron Y. Pinter Dept. of Computer Science Technion March 12, 2003.
DNA as Biological Information Rasmus Wernersson Henrik Nielsen.

DNA as Biological Information Rasmus Wernersson Henrik Nielsen.
Introduction to Genomics, Bioinformatics & Proteomics Brian Rybarczyk, PhD PMABS Department of Biology University of North Carolina Chapel Hill.

Introduction to Genomics, Bioinformatics & Proteomics Brian Rybarczyk, PhD PMABS Department of Biology University of North Carolina Chapel Hill.
The Cell, Central Dogma and Human Genome Project.

The Cell, Central Dogma and Human Genome Project.
Genetics and the Organism 10 Jan, 2005. Genetics Experimental science of heredity Grew out of need of plant and animal breeders for greater understanding.

Genetics and the Organism 10 Jan, Genetics Experimental science of heredity Grew out of need of plant and animal breeders for greater understanding.
CISC667, F05, Lec24, Liao1 CISC 667 Intro to Bioinformatics (Fall 2005) DNA Microarray, 2d gel, MSMS, yeast 2-hybrid.

CISC667, F05, Lec24, Liao1 CISC 667 Intro to Bioinformatics (Fall 2005) DNA Microarray, 2d gel, MSMS, yeast 2-hybrid.
Sanguinetti, 2012Bio2 lecture 1 Bioinformatics 2 “My main problem these days is that I don’t understand how we go from an experiment in the lab to a number.

Sanguinetti, 2012Bio2 lecture 1 Bioinformatics 2 “My main problem these days is that I don’t understand how we go from an experiment in the lab to a number.
Bioinformatics Original definition (1979 by Paulien Hogeweg): “application of information technology and computer science to the field of molecular biology”

Bioinformatics Original definition (1979 by Paulien Hogeweg): “application of information technology and computer science to the field of molecular biology”
Protein Interactions and Disease Audry Kang 7/15/2013.

Protein Interactions and Disease Audry Kang 7/15/2013.
Proteomics Understanding Proteins in the Postgenomic Era.

Proteomics Understanding Proteins in the Postgenomic Era.
9/30/2004TCSS588A Isabelle Bichindaritz1 Introduction to Bioinformatics.

9/30/2004TCSS588A Isabelle Bichindaritz1 Introduction to Bioinformatics.
Bioinformatics Predrag Radivojac I NDIANA U NIVERSITY.

Bioinformatics Predrag Radivojac I NDIANA U NIVERSITY.
What is bioinformatics?. What are bioinformaticians up to, actually? Manage molecular biological data –Store in databases, organise, formalise, describe...

What is bioinformatics?. What are bioinformaticians up to, actually? Manage molecular biological data –Store in databases, organise, formalise, describe...

Similar presentations

Ads by Google