1. The E-site story: Fundamental aspects of protein-synthesis Knud H. Nierhaus Max-Planck-Institute für Molekulare Genetik Berlin-Dahlem, Germany Tucson, 14 th September 2006

2. MPI MOLGEN, NH GROUP The E-site story: New aspects of the protein-synthesis 1.Introduction: Three tRNA binding sites Functional elements of the ribosomal elongation The ribosomal working plane of protein synthesis 2. Role of the E site I: molecular recognition and the solution of the ribosomal decoding riddle 3. Role of the E site II: Maintenance of the reading frame

3. MPI MOLGEN, NH GROUP

5. [ C ] t R N A b o u n d p e r 7 0 S 1 4 P h e 30 20 10 1.0 2.0 3.0 0 40 tRNA molar ratio tRNA:70S plus mRNA minus mRNA Rheinberger, Sternbach & Nierhaus, 1980, PNAS 78:5310-5314

6. Hausner et al., 1988, J. Biol. Chem. 263:13103

7. MPI MOLGEN, NH GROUP

8. The ribosomal interface provides a plane area for protein synthesis MPI MOLGEN, NH GROUP

9. The ribosomal interface provides a plane area for protein synthesis MPI MOLGEN, NH GROUP

10. The ribosomal interface provides a plane area for protein synthesis MPI MOLGEN, NH GROUP

11. Fitting of X-ray crystal structure of tRNA MPI MOLGEN, NH GROUP Elongation Cycle Movie! PRE POST 30S 50S Agrawal et al., 2000, J. Cell Biol. 150:447-459

12. The Ribosomal Elongation Cycle 3. Elongation Cycle MPI MOLGEN, NH GROUP Agrawal et al., 2000, J. Cell Biol. 150:447-459

13. MPI MOLGEN, NH GROUP The E-site story: New aspects of the protein-synthesis machinery 1.Introduction: Three tRNA binding sites Functional elements of the ribosomal elongation The ribosomal working plane of protein synthesis 2. Role of the E site I: molecular recognition and the solution of the ribosomal decoding riddle 3. Role of the E site II: Maintenance of the reading frame

14. Type I I I Type I Type I I MPI MOLGEN, NH GROUP Types of molecular recognition Nierhaus, 1993, Molecular Microbiology 9: 661-669

15. MPI MOLGEN, NH GROUP Nierhaus, 1993, Molecular Microbiology 9: 661-669

18. E site free and affinity at A sitehigh cognate (1 species) near-cognate (2-4 species) non-cognate (~50 species) E site occupied and affinity at A sitelow cognate near-cognate non-cognate  G ° c o g n a t e n e a r - c o g n a t e n o n - c o g n a t e c o g n a t e n e a r - c o g n a t e n o n - c o g n a t e  G °, f r e e e n e r g y o f A - s i t e b i n d i n g contribution by tRNA-mRNA interaction (codon-anticodon) contribution by tRNA-ribosome and Tu-ribosome interactions (A-site) Nierhaus, 1990, Biochemistry, 29:4997 MPI MOLGEN, NH GROUP

20. Geigenmüller and Nierhaus., 1990, EMBO J. 9:4527 MPI MOLGEN, NH GROUP dpm [ 14 C]Phe per fraction dpm [ 3 H]Asp per fraction

21. MPI MOLGEN, NH GROUP dpm [ 14 C]Phe per fraction dpm [ 3 H]Asp per fraction Geigenmüller and Nierhaus., 1990, EMBO J. 9:4527

22. MPI MOLGEN, NH GROUP dpm [ 14 C]Phe per fraction dpm [ 3 H]Asp per fraction Geigenmüller and Nierhaus., 1990, EMBO J. 9:4527

23. Hausner et al., 1988, J. Biol. Chem. 263:13103 MPI MOLGEN, NH GROUP Geigenmüller and Nierhaus., 1990, EMBO J. 9:4527

24. MPI MOLGEN, NH GROUP Nierhaus, 1993, Molecular Microbiology 9: 661-669

25. Valle et al., 2002, EMBO J. 21:3557 MPI MOLGEN, NH GROUP

26. Conclusions 1: Importance of the E site for the decoding The tRNA at the E site induces a low A-site affinity. This prevents the interference of non-cognate aa-tRNAs with the selection process. This means that a ribosome selects only one out of ≤4 aa-tRNAS (cognate+mis-cognate) instead of 1 out of ≈40. A mis-incorporation of a non-cognate aa-tRNA would be deleterious for the function of the corresponding protein in contrast to the mis-incorporation of a near-cognate aa- tRNA. Consequence of the E site effect: Selection of a near-cognate aa-tRNA destroys the function of a protein only 1 in 400 mis-incorporations due to the buffering of the codon lexicon. MPI MOLGEN, NH GROUP Nierhaus, 1993, Molecular Microbiology 9: 661-669

27. Ogle et al., 2001, Science 292:897

28. MPI MOLGEN, NH GROUP The E-site story: New aspects of the protein-synthesis machinery 1.Introduction: Three tRNA binding sites Functional elements of the ribosomal elongation The ribosomal working plane of protein synthesis 2. Role of the E site I: molecular recognition and the solution of the ribosomal decoding riddle 3. Role of the E site II: Maintenance of the reading frame

29. The importance of frameshift maintenance 5’- UUCUUCUUCUUCUUCUUCUUCUUCUUCUUCUUCUUCU -3’ 21 22 23 24 25 26 PhePhePhePhePhePhe 26 27 28 29 30 31 32 SerSerSerSerSerSerSer +1 frameshift MPI MOLGEN, NH GROUP

30. The mRNA from termination factor RF2 CUUAGGGGGUAUCUUUGACUCUGAUUCAAAAAGGGAU 5’- -3’ 21 22 23 24 25 26 26 27 28 29 30 31 32 Tyr Leu STOP Asp +1 frameshift MPI MOLGEN, NH GROUP

31. CUUAGGGGGUAUCUUUGACUCUGAUUCAAAAAGGGAU 5’- -3’ SD 21 22 23 24 25 26 26 27 28 29 30 31 32 Tyr Leu STOP Asp +1 frameshift The mRNA from termination factor RF2 MPI MOLGEN, NH GROUP

32. AAACUGGUUCCUUAGGGGGUAUCUUUGACUCUGAUUCAAAAAGGGAU EPA 5’- -3’ Tyr Leu SD Termination: 25 aa peptide +1 Frameshifting: Complete RF2 synthesis A U A G A G 21 22 23 24 25 26 26 27 28 29 30 31 32 mRNA of the termination factor RF2 MPI MOLGEN, NH GROUP

33. Hypothesis concerning the extensive frameshifting of the RF2 mRNA: 1 MPI MOLGEN, NH GROUP EPA 5’- -3’ 3‘- U C C U C C A’ Tyr Leu SD A U A G A G 16S rRNA ACUGGUUCCUUAGGGGGUAUCUUUGACUCUGAUUCAAAAAGGGAU

34. Hypothesis concerning the extensive frameshifting of the RF2 mRNA: 2 MPI MOLGEN, NH GROUP EPA 5’- -3’ Leu SD G A G Tyr A U A 3‘- U C C U C C A’ 16S rRNA AAACUGGUUCCUUAGGGGGUAUCUUUGACUCUGAUUCAAAAAGGGAU

35. Hypothesis concerning the extensive frameshifting of the RF2 mRNA: 3 5’- MPI MOLGEN, NH GROUP E P A -3’ SD G A G Leu C U G Asp +1 frameshift 3‘- U C C U C C A’ 16S rRNA AAACUGGUUCCUUAGGGGGUAUCUUUGACUCUGAUUCAAAAAGGGAU

36. Models of mRNAS for testing frameshifting of the RF2-mRNA type mRNA with SD Oligo(Phe) Arg Met Lys Leu Val Leu Val Leu Arg Gly Tyr Leu Stop GG UUC (UUC) 11 CGU AUG AAA CUG GUU CUU GUU CUU AGG GGG UAU CUU UGA CUC UGA UUC AAA AAG GGA U SD Asp Ser Asp Ser Lys Arg Asp mRNA without SD Arg Met Lys Leu Val Leu Val Leu Arg Gly Tyr Leu Stop GG UUC (UUC) 11 CGU AUG AAA CUG GUU CUU GUU CUU CGC GGC UAU CUU UGA CUC UGA UUC AAA AAG GGA U Ac[ 3 H]Phe incorporation Tyr- [ 32 P]tRNA binding [ 14 C]Asp incorporation = frameshift MPI MOLGEN, NH GROUP Models of mRNAS for testing frameshifting of the RF2-mRNA type Márquez et al., 2004, Cell 118:45-55

37. (UUC) 12 °°°°°°°°°°°°°°CGCGGCUAUCUUUGACUCUGAUUCAAAAAGGGAU E P A 3’-UCCUCCA GAG Leu Tyr AUA mRNA -SD 0 0.5 1 Asp incorporated 0.12  0.04 0.67  0.06 Synthesized peptide chain (Ac[ 3 H]Phe incorporation) E site tRNA [ 32 P] Frameshift [ 14 C] Asp incorporated MPI MOLGEN, NH GROUP 0.88  0.07 0 0.5 1 tRNA Tyr 0  0.03 (UUC) 12 °°°°°°°°°°°°°°AGGGGGUAUCUUUGACUCUGAUUCAAAAAGGGAU E P A 3’-UCCUCCA 16S rRNA SD GAG Leu Tyr AUA +SD Márquez et al., 2004, Cell 118:45-55

38. (UUC) 12 °°°°°°°°°°°°°°CGCGGCUAUCUUUGACUCUGAUUCAAAAAGGGAU E P A 3’-UCCUCCA GAG Leu Tyr AUA mRNA -SD (UUC) 12 °°°°°°°°°°°°°°AGGGGGUAUCUUUGACUCUGAUUCAAAAAGGGAU E P A 16S rRNA SD GAG Leu CUG Asp Tyr AUA +SD 0 0.5 1 0 1 tRNA Tyr Asp incorporated 0.88  0.07 0  0.03 0.12  0.04 0.67  0.06 Synthesized peptide chain (Ac[ 3 H]Phe incorporation) E site tRNA [ 32 P] Frameshift [ 14 C] Asp incorporated MPI MOLGEN, NH GROUP 3’-UCCUCCA Márquez et al., 2004, Cell 118:45-55

39. CUU GUU CUU AGG GGG UAU CUU UGA CUC 70 E P SD CUU GUU CAG GGG GUA UAU CUU UGA CUC 0 E P SD CUU AGG GGG UGU GUA UAU CUU UGA CUC 0 E P no SD CUU GUU CUU CGC GGC UAU CUU UGA CUC 6 E P mRNAs Frameshift ratio Asp incorp./ act. Ribosome % SD StopTyrLeu Shifting SD sequence upstream away from frameshifting site Márquez et al., 2004, Cell 118:45-55

40. Release of E-tRNA Cause or Consequence?

41. gggaaaacaaaacaaaac- UAC-CUU-UGAC-aaaacaaaacaaaac Tyr Leu Stop YL stop mRNA Asp

42. UAC C UUU GAC E P A E site free UAC CUU UGA C E P A ? + GTP GDP ? Márquez et al., 2004, Cell 118:45-55

43. UAC CUU UGA C E P A ? E site occupied GTP + Márquez et al., 2004, Cell 118:45-55 ? UAC CUU U GAC E P A 0510152025303540 0 2 4 6 8 10 12 0 2 4 6 8 10 12 Fraction number N-Ac[ 3 H]Leu[ 14 C]Asp [ 14 C]Asp [pmol] Ac[ 3 H]Phe [pmol]

44. Conclusions 2: Importance of the E site for maintenance of the reading frame The tRNA at the E site has to be removed in order to allow highly efficient frameshifting. The short spacer to the SD interaction blocks the –1 frameshift and probably fosters the +1 direction. Consequence: A tRNA at the E site and probably codon-anticodon interaction at the E site prevents mRNA slippage thus maintaining the reading frame.

45. Max-Planck-Institut für Molekulare Genetik, Berlin, Germany Peter Wurmbach Hans-Jörg Rheinberger Ute Geigenmüller Viter Marquez Daniel Wilson Nils Burkhardt Wadsworth Center, NY State Dept. of Health Albany, New York, USA Joachim Frank Rajendra Agrawal Christian Spahn Mikel Valle

46. Peptidyl chain Initiation posttranslocational pretranslocational Polypeptide chain

49. P gggaaaacaaaacaaaac- UAC-UUC-UGAC-aaaacaaaacaaaac Tyr Phe Stop YF stop mRNA Asp

50. UAC UUC UGA C E P A + GTP UAC UUC U GAC E P A GDP Fraction number 0510152025303540 0 2 4 6 8 10 12 14 16 18 0 2 4 6 8 10 12 14 16 18 N-Ac[ 3 H]Phe [ 14 C]Asp N-Ac[ 3 H]Phe-[ 14 C]Asp E site free Ac[ 3 H]Phe [pmol] [ 14 C]Asp [pmol]

51. POST PRE POST PRE Dabrowski et al., 1998, J. Biol. Chem. 273:32793 Ribosomal Elongation Cycle MPI MOLGEN, NH GROUP