Download presentation
Presentation is loading. Please wait.
1
Network (Reticulate) Evolution: Biology, Models, and Algorithms C. Randal Linder *, Bernard M.E. Moret † * University of Texas at Austin (currently the Program for Evolutionary Dynamics, Harvard University) † University of New Mexico
2
Purpose of Tutorial Familiarize you with the nature of reticulation in biology, especially hybrid speciation Discuss the implications of reticulation for our understanding of evolution Present currently available methods for simulating, detecting and reconstructing reticulation Consider deficiencies of the current methods
3
Overview of Reticulation in Biology What happens at the genetic level? How does it relate to population genetic processes? –In particular, what processes can give the appearance of species level reticulation How can we detect it? How can we reconstruct it? What biological tools need to be in place to generate the requisite data?
4
Idealized Nature Wouldn’t it be nice if… –Sexual creatures would just behave themselves –Asexual lineages would keep their pseudopods to themselves
5
Then we could stick with bifurcating graphs (trees) to properly describe the evolutionary history of organismal lineages A B C D E F G H
6
Unruly Nature Whatever is not forbidden will occur. -- Gerald Myers (ca 1980)
7
In Other Words Nature does not care about our nice systems Rather, the only rule is: –If a set of genes can be brought together in a cell, survival and reproduction will be determined by the phenotype produced in the environment of the organism. If the organism can survive and reproduce as well as or better than its competitors, it “works” no matter the mating/process that produced it
8
Therefore Some “species” are able to interbreed or exchange genes in ways that violate “normal” notions about species and speciation Reticulation is violation of the independence of each evolutionary lineage –Instead of bifurcation, lineages can mix and produce new lineages
9
This leads to the production of networks instead of trees A B C D E F G H I
10
Molecular phylogeneticists will have failed to find the “true tree,” not because their methods are inadequate or because they have chosen the wrong genes, but because the history of life cannot properly be represented as a tree. --Ford Doolittle
12
Before Reticulation Paradoxically, I’ll begin with non-reticulate evolution Bifurcating evolution (and sometimes hard polytomies) –Evolutionary lineages split and evolve independently from one another
13
Before Reticulation Key Evolutionary Insight: Because all evolution is a product of change from one generation to the next, the information must initially change in some form of bifurcating process. agct gcct agct acct agctacctagatgcctgact
14
With Reticulation The end result is admixture of different evolutionary histories agct acat agct acatagctacct
15
Levels of Reticulation Life is organized hierarchically and so reticulation can occur at different levels –Chromosomal (meiotic recombination) –Population(sexual recombination) –Species (interspecific hybridization and horizontal gene transfer)
16
Levels of Reticulation Chromosomal (meiotic recombination)
17
Levels of Reticulation Population (sexual recombination of haploid genomes)
18
Levels of Reticulation Species (hybridization and gene transfer)
19
Levels Nested within Levels
20
Areas of Biological Research Most of the work on reticulation has been done at the population genetic level –A great deal of work on recombination, especially meiotic recombination Hybrid speciation and lateral gene transfer are less well studied –Intersect with the population genetic perspective –Will talk about this a bit later and from other speakers
21
Types of Hybrid Speciation Allopolyploidization: each parent of the hybrid contributes it’s entire nuclear genome (usually uniparental inheritance of the organelles) –Parents needn’t have the same number of chromosomes
22
Types of Hybrid Speciation Diploid (Homoploid) Hybridization: each parent contributes half of its diploid chromosome set, as it would with normal sex. –Parents almost always have the same number of chromosomes
23
Types of Hybrid Speciation Autopolyploidization: a doubling of the diploid chromosome number in a single species –From a biological and topological perspective, could be considered a type of bifurcating speciation
24
Horizontal Gene Transfer Hybridization between lineages, but an independent lineage is not produced –Hybrids backcross to one or both parents allowing introgression of genes between “species” Genes are moved between lineages by a third party (vector), e.g., a virus
25
Horizontal Gene Transfer: Introgressive Hybridization
26
Horizontal Gene Transfer: Genome Capture A complete organellar genome is transferred by hybridization
27
Horizontal Gene Transfer: Bacterial Sex Genetic material is moved by conjugation between compatible bacteria
28
Bacteria: Promiscuous DNA Sharers Lawrence, Ochman estimated that 755 of 4,288 ORFs in E. coli were from at least 234 lateral gene transfer events (Proc. Natl Acad. Sci. USA 95, 9413-9417 (1998) ) General evidence:
29
Horizontal Gene Transfer: Exchange by a Vector Genetic material is moved by a third party such as a virus or a combination of organisms, e.g., mosquito and protozoan.
30
Neworks Have Incongruent Trees Within Them
31
Reticulation Events Have Incongruent Trees Within Them
33
Fundamental Insight At the lowest possible level (individual DNA nucleotides on a single DNA strand) all evolution is ultimately tree-like.
34
How Might We Detect Reticulation? Fundamentally, reticulation is a mixing of different evolutionary signals. Therefore: –The signal from a genome that has experienced reticulation will be an “average” of its parents (Median approach) –Unrecombined stretches of DNA will have a signal that comes from one parent. (Incongruence approach) Will see both approaches in methods for detection and reconstruction
35
Evolutionary Events that Mimic Species-Level Reticulation Lineage Sorting (gene tree/species tree problem) Reticulation at lower levels, e.g., meiotic recombination
36
Evolutionary Events that Mimic Species-Level Reticulation Lineage Sorting (gene tree/species tree problem) –When reconstructing a species-level phylogeny using DNA sequence information we are actually reconstructing a gene tree. –Ancient alleles (alleles arising prior to some monophyletic group) may not be inherited by all species. –In essence, it is either a sampling problem or an irretrievable information loss problem.
37
Gene Tree/Species Tree
38
All of the versions of a gene from a single common history (everything that is the same color) are referred to as orthologues. Versions of a gene from a duplication event or the production of a new allele are paralogues
39
Gene Tree/Species Tree
45
Under a molecular clock, it is possible to detect the difference between incongruence due to hybridization and to a gene tree/species tree sampling problem. GT/ST incongruences will occur at different depths.
46
Evolutionary Events that Mimic Species-Level Reticulation Reticulation at lower levels, e.g., meiotic recombination –Recombination can lead to loss of an allele for a lineage in a particular region of DNA essentially giving rise to a lineage sorting problem.
47
Recombination Example
48
Second Key Insight Events that masquerade as species-level reticulate evolution are always the product of either true data loss or inadequate sampling. –Here, we encounter the importance of a population genetic perspective in phylogenetics.
49
Given the problem of misleading signals, how can we distinguish true species- level reticulation from reticulation at other levels, simple data loss, and inadequate sampling?
50
Possible Solution Increase the number of individuals sampled from a species/population and the number of markers. Therefore, must take a multiple marker approach to recovering the species- level relationships –Data loss and lower level reticulation events should almost always act randomly with respect to which phylogeny is favored –Species-level reticulation will be biased toward a particular interpretation
51
Practical Concerns Practical problems (for biologists): –Cost –Time –Lack of prior knowledge that all of the orthologues are there to be found
52
Caveats Reticulation events that quickly follow speciation may not be detectable Ancient reticulation events may not be recoverable The computational requirements to detect and reconstruct reticulation may be considerable We may have to rethink our ideas of species (levels/units of speciation)
53
Assembling the Network of Life: ANOL
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.