1. Cancer Genetics for Primary Care Sara Levene Registered Genetic Counsellor

2. Proportion of cancer that is inherited Inherited susceptibility to cancer: ‘genetic’ Single genes Family history of cancer: ‘familial’ ?multi-factorial origins No family history of Cancer: ‘sporadic’ ?multi-factorial origins Population risk: Breast cancer 1:10 Ovarian cancer 1:100 Colorectal cancer 1:25 - 35

3. To make a long story short: All cancer is genetic Cancer is rarely inherited

4. Sporadic cancer hormones viruseschemicals radiation Spontaneous mutations 2 normal genes 1 normal gene 1 mutated gene 2 mutated genes cancer 1 normal gene 1 mutated gene 2 mutated genes cancer Inherited cancer hormones viruseschemicals radiation Spontaneous mutations

5. Inherited Mutations and Cancer Inherited mutations relating to cancer do not cause cancer Mutations are often found in genes that are ‘tumour suppressors’ Mutations mean that protection from cancer is lost or reduced Mutations lead to increased susceptibility to certain types of cancer

6. Autosomal dominant inheritance mother father child Each child has 50:50 chance of inheriting the altered gene.

7. Genetic testing

8. Cancer Genes Mendelian Inheritance (AD) In the last 10 years several genes relating to specific cancer syndromes have been identified There are more cancer genes waiting to be ‘discovered’ It is difficult to locate the exact mutation in a cancer gene for a particular family

9. Cancer Genes Multi-factorial Inheritance More recently the search for other AD genes has led to the discovery of some ‘lower risk’ genes eg. CHEK2 –found in ~2% cases ca br –est doubles risk of ca br ? Liability/threshold model with several similar genes (+ env factors) This research is not yet applicable to clinical practice

10. Genetic Testing Technically difficult Can only be offered to high risk families Can only search small number of high risk dominant genes Can take more than a year to search for the mutation in a family Often cannot locate the mutation for a family (?unknown genes)

11. Searching for the faulty gene cgattgaggatcgtacgtattaacggtagctataccagtcgatccattggagtcatcgatgtt cgattgaggatcgtacgtattaacggtagctataccagtcgatccattggagtcatcgatgtt cgattgaggatcgtacgtattaacggtagctataccagtcgatccattggagtcatcgatgtt cgattgaggatcgtacgtattaacggtagctataccagtcgatccattggagtcatcgatgtt cgattgaggatcgtacgtattaacggtagctataccagtcgatccattggagtcatcgatgtt cgattgaggatcgtacgtattaacggtagctataccagtcgatccattggagtcatcgatgtt cgattgaggatcgtacgtattaacggtagctataccagtcgatccattggagtcatcgatgtt cgattgaggatcgtacgtattaacggtagctataccagtcgatccattggagtcatcgatgtt cgattgaggatcgtacgtattaacggtagctataccagtcgatccattggagtcatcgatgtt cgattgaggatcgtacgtattaacggtagctataccagtcgatccattggagtcatcgatgtt cgattgaggatcgtacgtattaacggtagctataccagtcgatccattggagtcatcgatgtt cgattgaggatcgtacgtattaacggtagctataccagtcgatccattggagtcatcgatgtt cgattgaggatcgtacgtattaacggtagctataccagtcgatccattggagtcatcgatgtt cgattgaggatcgtacgtattaacggtagctataccagtcgatccattggagtcatcgatgtt cgattgaggatcgtacgtattaacggtagctataccagtcgatccattggagtcatcgatgtt a

12. Genetic Testing First test in family always done on person who has had the cancer (mutation search test) If no living affected relatives available – cannot offer genetic test for family If a mutation is found predictive testing can be offered to at-risk relatives: –If relative doesn’t carry familial mutation they are not at increased risk of cancer (still at population risk) –If a person does carry the familial mutation they are at increased risk of developing cancer

13. Family History of Breast Cancer

14. High Risk Cancer risks associated with BRCA1 and BRCA2 Breast and ovarian cancer Breast cancer risk ~80% Ovarian cancer risk ~45% Increased risk of second primary for women who have already had breast cancer Other cancers Prostate cancer Male breast cancer Pancreatic cancer Colorectal cancer Stomach cancer

15. Recent NICE Guidelines on Familial Breast Cancer Women at or near population risk are cared for in primary care. Women at moderate risk are cared for in secondary care. Women at high risk are cared for in tertiary care.

16. Breast cancer case study 1 Ca breast, diag 70y Died 85y Brain tumour, died 67y ? Prev breast cancer in 40s? 68y

17. Breast cancer case study 1 Ca breast, diag 70y Died 85y Brain tumour, died 67y No record of prev ca br 68y Can this patient now be reassured?

18. Population risk Screening and management National breast screening from 50y Breast awareness Reassure patient: – For most women, increasing age is the greatest risk factor. – The great majority of women with a family history of breast cancer do not fall into a high-risk category and do not develop breast cancer.

19. Breast cancer case study 2 Ca breast, diag 52y 20y Ca breast, diag 54y Patient is requesting screening and is considering prophylactic mastectomies. What is her level of risk? What is appropriate management of her risk? Patient is also interested in genetic testing. Can this be offered?

20. Moderate risk Referral to secondary care Female breast cancers One 1st degree relative diagnosed before age 40 Two 1st degree relatives ( or one 1st degree relative and one 2nd degree relative ) diagnosed after average age 50

21. Moderate risk Screening and management Annual breast surveillance from age 40 – 50y National Breast Screening from 50y. ?Chemoprevention studies Breast awareness

22. Ca breast Diag 32y Ca breast Died 40y Breast cancer case study 3 What can we offer this family? Considering prophylactic mastecomies

23. Ca breast Diag 32y Blood taken for BRCA1/2 testing Ca breast Died 40y Breast cancer case study 3 Recommend screening

24. Ca breast Diag 32y BRCA1/2 testing on-going Ca breast Died 40y Breast cancer case study 3 Ca breast Diag 35y

25. Ca breast Diag 32y BRCA1 mutation found Ca breast Died 40y Breast cancer case study 3 Ca breast Diag 35y

26. Ca breast Diag 32y BRCA1 mutation found Ca breast Died 40y Breast cancer case study 3 Ca breast Diag 35y BRCA1 mutation carrier N BRCA1 mutation carrier

27. High risk Referral to secondary care, then tertiary care Two 1st degree relatives (OR one 1st degree relative and one 2nd degree relative) with breast cancer, av age <50 Three or more 1st or 2nd degree relatives with breast cancer at any age One 1st degree male relative with breast cancer at any age One 1st degree relative with bilateral breast cancer where 1st primary diagnosed <50 One 1st or 2nd degree relative with ovarian cancer at any age and one 1st or 2nd degree relative with breast cancer at any age

28. High risk Screening and management 30-39y: may be eligible for annual mammograms 40-49y: annual mammograms >50y: NBSP, plus may be eligible for additional screening Refer to genetics to discuss genetic testing ?MRI screening in the future ?Prophylactic surgery ?Ovarian screening

29. Breast cancer case study 4 Ca breast, diag 51y Died 53y Ca breast, diag 41y Ca ?type What should we do for this family?

30. Breast cancer case study 4 Ca breast, diag 51y Died 53y Ca breast, diag 41y Ca ovary, died 48y Breast & ovarian screening

31. Breast cancer case study 4 Ca breast, diag 51y Died 53y Ca breast, diag 41y Blood taken for BRCA1/2 testing Ca ovary, died 48y Breast & ovarian screening

32. Breast cancer case study 4 Ca breast, diag 51y Died 53y Ca breast, diag 41y BRCA1/2 tested No mutations found Ca ovary, died 48y Considering surgery

33. Other factors to consider: Paternal history: two or more breast cancers on father ’ s side of family Unusual cancers: Bilateral breast cancer Male breast cancer Ovarian cancer Sarcoma <45y Glioma or childhood adrenal cortical carcinoma Complicated patterns of multiple cancers at young age Jewish ancestry Women with Jewish ancestry are around 5 – 10 times more likely to carry BRCA1 or BRCA2 mutations than women in non-Jewish populations.

34. Family History of Colorectal Cancer

35. FAP Familial Adenomatous Polyposis 100% affected by 35y Hundreds/thousands of polyps in colon Mutation on APC gene Accounts for <1% colon cancers Other cancer risks: duodenal, gastric Up to 80% lifetime risk Less than 10 polyps found At least 5 genes found Accounts for up to 5% of colon cancers Other cancer risks: endometrial, ovarian, gastric HNPCC Hereditary Non-Polyposis Colon Cancer

36. Familial Adenomatous Polyposis (FAP)

37. CRC FH Risk categorisation Low risk One FDR with CRC at > 45 (No screening required, bowel awareness) Low-Moderate risk Two FDRs with CRC at average age > 60. Screening: One colonoscopy at 35y-40y and one at 55y High-Moderate risk One FDR with CRC 50. Screening: Begins at 45 or 5yrs prior to youngest diagnosis (not prior to 35). Repeat 5yrly to 75y.

38. What is High Risk? A known polyposis syndrome e.g. FAP Be sure to ask if there is any history of polyposis in the family. HNPCC (Amsterdam positive families). –At least 3 of HNPCC related cancers (CRC, endometrium, ovarian, small bowel, ureter or renal pelvis) –One should be a FDR of the other two –At least two successive generations affected –At least one cancer diagnosed < 50 years

39. HNPCC Colonoscopies from 25y, continuing 2 yearly to 75y ?Endometrial/ovarian screening annually from 35y (research) FAP Colonoscopies annually from teens (or younger depending on family history) Prophylactic colectomy offered ?Upper GI screening annually (research) High risk screening/management

40. Summary Most cancer is not due to dominant, high-risk genes. Most patients with a family history of cancer can be reassured and possibly referred for screening. For most patients with a family history of cancer, current genetic testing is not helpful and is not available. Patients with a high risk of cancer due to family history can have screening, and genetic testing may be available. Patients who inherit a mutation in a high risk gene have a high risk of developing cancer themselves.

41. Take-home messages Young diagnoses of cancer (<45y) may be significant Three or more cases of the same / related types of cancer, in one family (even if older ages) may be significant Genetic testing may or may not be available / informative for a given family Genetic testing must start with a living affected relative Screening may be available

42. If you have enquiries about a family history : Contact your local Clinical Genetics dept: Clinical Genetics Great Ormond Street Hospital London WC1N 3JH Tel: 0207 905 2138 Clinics held at Barts and The London.