2. 3rd Quiz, Name, date, email 1 Pick one of the following two: –A)Explain how environmental changes can increase severity of disease –B)Why is it useful to be able to follow individual genotypes (strains) of a microbe? 2 Pick one of the following two: –A) What is the likleihood of a host shift for an exotic pathogen? –B)- What are R and avr genes?

3. “Emergent diseases”: 3: exotic pathogens 99% of times human responsible for their introduction99% of times human responsible for their introduction

4. Like the conquistadores brought diseases that were lethal to those who had never been exposed to them, so do exotic diseases cause true devastation in plant communities because of lack of coevolution between hosts and microbes

5. California invaded: 1849 A.D. New hybrid root pathogen 1990s White pine blister rust 1930s Port Orford Cedar Root Disease 1950s Pitch canker disease 1980s Dutch Elm Disease 1960s Sudden Oak Death 1990s Oak root canker 2000 Manzanita/madrone die-back Canker-stain of Sycamores 1980’s

6. How can people transport pathogens By transporting plants and plant parts –Crops, and seeds –Raw food –Ornamental plants Untreated lumber Soil Insects vectoring fungi Military activity

7. The Irish Potato Famine From 1845 to 1850 Phytophthora infestans Resulted in the death of 750,000 Emigration of over 2 million, mainly to the United States.

8. What favors invasion of exotic fungi ? –Density of host increases severity of disease _ Presence of related hosts phylogenetic signal) –Corridors linking natural habitats –Synchronicity between host susceptibility and pathogen life cycle –Ecological and environmental conditions –Disturbances –Capacity of pathogen to survive in unfavorable conditions –Transmission rate

10. Girdling aerial ‘cankers’ removed from roots

11. Big Sur 2006 K. Frangioso

12. P. ramorum present P. ramorum absent Wickland et al., unpublished

13. P. ramorum growing in a Petri dish

14. Organism new to science Origin unknown Biology unknown Symptoms caused unknown Immediately though highly regulated

15. Stem canker Leaf necrosis Rhododendron: In EU mostly a nursery issue, but also present in nurseries in US and Canada

16. Phytophthora ramorum Sporangia Chlamydospores

17. Is it exotic? Our studies have indicated that California population is extremely simplified, basically two strains reproducing clonally as expected of an introduced organism Many hosts appear to have no resistance at all Limited geographic distribution

18. Where does it come from? It is unknown where pathogen originally comes from, but previous studies have shown that California forest population is derived from a relatively genetically diversified US nursery population, indicating ornamental nurseries were the most likely avenue for pathogen introduction

19. Let’s look at its genetic structure Need a number of independent and neutral DNA markers Used AFLP, a technique that scans the entire nuclear genome Are our isolates the same as the European ones? Is the genetic structure suggestive of an introduced or native species?

20. US forest isolates clearly distinct from EU nursery isolates, also have different mating type Isolates from nurseries in WA, OR, & BC both of the US and EU types Potential for XXX sex and recombination in US nurseries US forest population is genetically very homogeneous, trademark of an introduced species

21. The entire genome was sequenced in less than 3 years since discovery of organism * 12 SSR loci (di- and tri- repeats identified) * Loci selected to be polymorphic both between and within continental populations * 500+ representative isolates analyzed CCGAAATCGGACCTTGAGTGCGG AGAGAGAGAGAGA CTGTACGAGCCCGAGTCTCGCAT

22. Mating Type A1 A2 Growth Rate Fast Slow Fast

23. Terminology Genotype Lineage Population

24. Results of 1st microsatellite study There actually three distinct (genotypically and phenotypically) lineages of P. ramorum Very low diversity in US forests (microsats cannot discriminate among individuals, clonality confirmed), only one lineage Several genotypes but only one lineage in EU nurseries Three lineages in US nurseries

25. Was the pathogen first in US forests or in US nurseries? Slide 12

26. Was the pathogen first in US forests or in US nurseries? Slide 12 nurserie s forests

27. Where was it introduced? First reports mid 90’s Pathogen identified in 2000 By then, the pathogen was widespread CLUES: severity of symptoms and anedoctal stories Positive isolation P. ramorum

28. We found same genotypes in nurseries and forests proving origin of wild outbreak

29. nurseries Introduction phase 1- Escape of pathogen from Infected nursery plants at two locations: Mount Tamalpais (Marin County), and Scott’s Valley (Santa Cruz County) 2- Nurseries and two sites have identical strain composition, but distance between sites is impossible for natural spread of organism

30. What favors invasion of exotic fungi ? –Density of host increases severity of disease –Corridors linking natural habitats –Synchronicity between host susceptibility and pathogen life cycle –Ecological and environmental conditions

31. Bay/Oak association Bleeding canker Canker margin in phloem Bay Coast Live Oak (no sporulation) Sporangia

34. Infectious diseases spread not randomly but around initial infections

35. Mantel test among all individuals. [Moran ’ s I vs ln (geographic distance)] Site ID Correlation coeff. (r) P-value (1000,000 perm) ALL -0.2153<0.000001

36. Synchrony pathogen-host Susceptibility of oaks (lesion size)

37. Wetness > 12 h Temp >19 C

38. Bay Laurel / Tanoak SOD Spore Survey Date Temp (C) Rain (mm)

39. How to control emergent exotic diseases PREVENT THEIR INTRODUCTION LIMIT THE HUMAN-SPREAD OF PATHOGENS (infected plants, plant parts, dirty tools) EMPLOY HOST RESISTANCE CHEMICAL AND OTHER MITIGATION STRATEGIES

40. Forest pathogens can never be eradicated

42. PREVENT: Diagnose Symptoms relatively generic, very variable, and pathogen not always culturable LAB CULTURES DNA TESTS

44. AgriFos and PentraBark Topical Application +

45. Agrifos vs. Azomite Treatments (efficacy 1 - 24 months) Canker Size (mm) a a b

46. Why emphasis on molecular analyses? As a way to identify and quantify microbes in the environment As a way to understand microbial biology: how do microbes reproduce and infect hosts As a way to determine epidemiology: follow the movement of a strain

47. Why emphasis on molecular analyses? As a way to determine potential for spread: use genes as markers for individuals As a way to determine whether population of microbes is exotic or native As a way to identify source of a pathogen and migration patterns

48. Why emphasis on molecular analyses? As a way to determine the size of the gene pool of a pathogen, Important to scale management options As a way to determine rapid evolutionary changes linked to an introduction As a way to determine epigenetic effects

49. New host pathogen combinations Pathogen stays/Plant moves: invasive plant Pathogen moves/Plant stays: exotic epidemic Pathogen moves/Plant moves: biological control

50. Success. The “1:10” rule Can exotic withstand new environment Can it withstand attacks of predators Can it outcompete similar native organisms by accessing resources –Can a pathogen be pathogenic –Can a pathogen be sufficiently virulent

51. Invasion driven by ecological conditions Enemy release hypothesis Resource availability (pathogenicity/virulence)

52. Pathogenicity Qualitative: ability to cause disease Often regulated by a single gene Avr genes in pathogen and resistance genes in host

53. Gene for gene Resistance in host is dominant Virulence is recessive ar aR Ar AR

54. Gene for gene Resistance in host is dominant Virulence is recessive ar aR Ar AR Resistance: no disease

55. Functions of avr/R genes Avr genes may help detoxify plant enzymes, secure necessary aminoacids or proteins, plant toxins, promoting pathogen growth. Normally they are mobile, wall-bound products R genes normally recognize multiple avr genes and start hypersensitive response (programmed cell death)

56. Avr/R genes matches are specific Race of the pathogen (avr1) matched by variety of the crop (R1). At the base of crop breeding science If R genes target avr genes linked to important housekeeping functions, they are more durable

57. Can be R genes accumulated? There is a cost associated with R genes Mostly R genes initiate costly defense processed, often even when challenged by innocuous microbes Some evidence that in absence of specific avr, R are lost

58. Plants immune response Plants do not possess an immune system such as that of animals They do recognize pathogens Recognition initiates secondary metabolic processes that produce chemicals that will stop or slow microbial infections: thickening of cell wall, premature cell death (HR response), systemic resistance

59. Virulence: quantitative response Multiple genes controlling: –Phenotypic traits conferring virulence –Production of plant detoxifying enzymes –Production of plant toxins

60. CAN WE PREDICT: Success of an exotic microbe? –Survival structures such as cysts, spores, etc –Saprotrophic ability (ability to feed on dead matter) –Degree of host specialization, the more specialized the harder it may be to establish –Phylogenetic distance of hosts (the closertive and new hosts are, the easier the establishment) –Similar ecology

61. CAN WE PREDICT: Levels of the epidemic? –Density dependence: abundance of susceptible hosts –Genetic variation in host. In general it is assumed that genetic variation in host populations slows down epidemics, however backing data from natural ecosystems is missing. It could be that low genetic diversity associated with widespread presence of resistance may be more beneficial than genetic variability

62. CAN WE PREDICT: Selection of increased R in host? –Host: R to exotic may be significantly present because it identifies native pathogen. –R may be absent. –R may be present at low frequency. If host does not exchange genes long distance, but only in areas already infested there is a stronger selection process. Otherwise locally selected R genes may be swamped by genes coming from outside the area of infestation –Shorter generation times favor pathogen