Presentation is loading. Please wait.

Presentation is loading. Please wait.

DNA Sequencing and Assembly

Similar presentations


Presentation on theme: "DNA Sequencing and Assembly"— Presentation transcript:

1 DNA Sequencing and Assembly

2 DNA sequencing How we obtain the sequence of nucleotides of a species
…ACGTGACTGAGGACCGTG CGACTGAGACTGACTGGGT CTAGCTAGACTACGTTTTA TATATATATACGTCGTCGT ACTGATGACTAGATTACAG ACTGATTTAGATACCTGAC TGATTTTAAAAAAATATT…

3 Which representative of the species?
Which human? Answer one: Answer two: it doesn’t matter Polymorphism rate: number of letter changes between two different members of a species Humans: ~1/1,000 – 1/10,000 Other organisms have much higher polymorphism rates

4 DNA sequencing – vectors
Shake DNA fragments Known location (restriction site) Vector Circular genome (bacterium, plasmid) + =

5 Different types of vectors
Size of insert Plasmid 2,000-10,000 Can control the size Cosmid 40,000 BAC (Bacterial Artificial Chromosome) 70, ,000 YAC (Yeast Artificial Chromosome) > 300,000 Not used much recently

6 DNA sequencing – gel electrophoresis
Start at primer (restriction site) Grow DNA chain Include dideoxynucleoside (modified a, c, g, t) Stops reaction at all possible points Separate products with length, using gel electrophoresis

7 Electrophoresis diagrams

8 Output of gel electrophoresis: a read
A read: nucleotides A C G A A T C A G …. A Quality scores: -10log10Prob(Error) Reads can be obtained from leftmost, rightmost ends of the insert Double-barreled sequencing: Both leftmost & rightmost ends are sequenced

9 Method to sequence segments longer than 500
genomic segment cut many times at random (Shotgun) Get one or two reads from each segment ~500 bp ~500 bp

10 Reconstructing the Sequence (Fragment Assembly)
reads Cover region with ~7-fold redundancy (7X) Overlap reads and extend to reconstruct the original genomic region

11 Definition of Coverage
Length of genomic segment: L Number of reads: n Length of each read: l Definition: Coverage C = nl/L How much coverage is enough? (Lander-Waterman model): Assuming uniform distribution of reads, C=10 results in 1 gapped region /1,000,000 nucleotides

12 Challenges with Fragment Assembly
Sequencing errors ~1-2% of bases are wrong Repeats Computation: ~ O( N2 ) where N = # reads false overlap due to repeat

13 Repeats Bacterial genomes: 5% Mammals: 50% Repeat types:
Low-Complexity DNA (e.g. ATATATATACATA…) Microsatellite repeats: (a1…ak)N where k ~ 3-6 (e.g. CAGCAGTAGCAGCACCAG) Common Repeat Families SINE (Short Interspersed Nuclear Elements) (e.g. ALU: ~300-long, 106 copies) LINE (Long Interspersed Nuclear Elements) ~500-5,000-long, 200,000 copies MIR LTR/Retroviral Other -Genes that are duplicated & then diverge (paralogs) -Recent duplications, ~100,000-long, very similar copies

14 What can we do about repeats?
Two main approaches: Cluster the reads Link the reads

15 What can we do about repeats?
Two main approaches: Cluster the reads Link the reads

16 Strategies for sequencing a whole genome
Hierarchical – Clone-by-clone Break genome into many long pieces Map each long piece onto the genome Sequence each piece with shotgun Example: Yeast, Worm, Human, Rat Online version of (1) – Walking Start sequencing each piece with shotgun Construct map as you go Example: Rice genome Whole genome shotgun One large shotgun pass on the whole genome Example: Drosophila, Human (Celera), Neurospora, Mouse, Rat, Fugu

17 Hierarchical Sequencing

18 Hierarchical Sequencing Strategy
a BAC clone map genome Obtain a large collection of BAC clones Map them onto the genome (Physical Mapping) Select a minimum tiling path Sequence each clone in the path with shotgun Assemble Put everything together

19 Methods of physical mapping
Goal: Make a map of the locations of each clone relative to one another Use the map to select a minimal set of clones to sequence Methods: Hybridization Digestion

20 1. Hybridization p1 pn Short words, the probes, attach to complementary words Construct many probes Treat each BAC with all probes Record which ones attach to it Same words attaching to BACS X, Y  overlap

21 Hybridization – Computational Challenge
p1 p2 …………………….pm Matrix: m probes  n clones (i, j): 1, if pi hybridizes to Cj 0, otherwise Definition: Consecutive ones matrix A matrix 1s are consecutive Computational problem: Reorder the probes so that matrix is in consecutive-ones form Can be solved in O(m3) time (m >> n) Unfortunately, data is not perfect 0 0 1 …………………..1 C1 C2 ……………….Cn 1 1 0 …………………..0 1 0 1…………………...0 pi1pi2…………………….pim ……………..0 ……………..0 ……………..0 Cj1Cj2 ……………….Cjn ……… ………

22 2. Digestion Restriction enzymes cut DNA where specific words appear
Cut each clone separately with an enzyme Run fragments on a gel and measure length Clones Ca, Cb have fragments of length { li, lj, lk }  overlap Double digestion: Cut with enzyme A, enzyme B, then enzymes A + B

23 Whole-Genome Shotgun Sequencing

24 Whole Genome Shotgun Sequencing
cut many times at random plasmids (2 – 10 Kbp) forward-reverse linked reads known dist cosmids (40 Kbp) ~500 bp ~500 bp

25 The Overlap-Layout-Consensus approach
1. Find overlapping reads 2. Merge good pairs of reads into longer contigs 3. Link contigs to form supercontigs 4. Derive consensus sequence ..ACGATTACAATAGGTT.. + many heuristics

26 1. Find Overlapping Reads
Sort all k-mers in reads (k ~ 24) Find pairs of reads sharing a k-mer Extend to full alignment – throw away if not >95% similar TACA TAGT || TAGATTACACAGATTAC T GA TAGA | || ||||||||||||||||| TAGATTACACAGATTAC

27 1. Find Overlapping Reads
One caveat: repeats A k-mer that appears N times, initiates N2 comparisons ALU: 1,000,000 times Solution: Discard all k-mers that appear more than c  Coverage, (c ~ 10)

28 1. Find Overlapping Reads
Create local multiple alignments from the overlapping reads TAGATTACACAGATTACTGA TAGATTACACAGATTACTGA TAG TTACACAGATTATTGA TAGATTACACAGATTACTGA TAGATTACACAGATTACTGA TAGATTACACAGATTACTGA TAG TTACACAGATTATTGA TAGATTACACAGATTACTGA

29 1. Find Overlapping Reads (cont’d)
Correct errors using multiple alignment C: 20 C: 20 C: 35 C: 35 T: 30 C: 0 C: 35 C: 35 TAGATTACACAGATTACTGA C: 40 C: 40 TAGATTACACAGATTACTGA TAG TTACACAGATTATTGA TAGATTACACAGATTACTGA TAGATTACACAGATTACTGA A: 15 A: 15 A: 25 A: 25 - A: 0 A: 40 A: 40 A: 25 A: 25 Score alignments Accept alignments with good scores

30 Basic principle of assembly
Repeats confuse us Ability to merge two reads  ability to detect repeats We can dismiss as repeat any overlap of < t% similarity Role of error correction: Discards ~90% of single-letter sequencing errors  Threshold t% increases

31 2. Merge Reads into Contigs (cont’d)
repeat region Merge reads up to potential repeat boundaries (Myers, 1995)

32 2. Merge Reads into Contigs (cont’d)
repeat region Ignore non-maximal reads Merge only maximal reads into contigs

33 2. Merge Reads into Contigs (cont’d)
repeat boundary??? sequencing error b a Ignore “hanging” reads, when detecting repeat boundaries

34 2. Merge Reads into Contigs (cont’d)
????? Unambiguous Insert non-maximal reads whenever unambiguous

35 3. Link Contigs into Supercontigs
Normal density Too dense: Overcollapsed? (Myers et al. 2000) Inconsistent links: Overcollapsed?

36 3. Link Contigs into Supercontigs (cont’d)
Find all links between unique contigs Connect contigs incrementally, if  2 links

37 3. Link Contigs into Supercontigs
Fill gaps in supercontigs with paths of overcollapsed contigs

38 3. Link Contigs into Supercontigs
d ( A, B ) Contig A Contig B Define G = ( V, E ) V := contigs E := ( A, B ) such that d( A, B ) < C Reason to do so: Efficiency; full shortest paths cannot be computed

39 3. Link Contigs into Supercontigs
Contig A Contig B Define T: contigs linked to either A or B Fill gap between A and B if there is a path in G passing only from contigs in T

40 4. Derive Consensus Sequence
TAGATTACACAGATTACTGA TTGATGGCGTAA CTA TAGATTACACAGATTACTGACTTGATGGCGTAAACTA TAG TTACACAGATTATTGACTTCATGGCGTAA CTA TAGATTACACAGATTACTGACTTGATGGCGTAA CTA TAGATTACACAGATTACTGACTTGATGGGGTAA CTA TAGATTACACAGATTACTGACTTGATGGCGTAA CTA Derive multiple alignment from pairwise read alignments Derive each consensus base by weighted voting

41 Mouse Genome Several heuristics of iteratively:
Breaking supercontigs that are suspicious Rejoining supercontigs Size of problem: 32,000,000 reads Time: 15 days, 1 processor Memory: 28 Gb N50 Contig size: Kb  24.8 Kb N50 Supercontig size: Mb  16.9 Mb

42 Mouse Assembly

43 Sequencing in the (near) future
CMOS Chip Photodiodes 10mm 4mm Microfluidic Chip Inlet Outlet 6mm


Download ppt "DNA Sequencing and Assembly"

Similar presentations


Ads by Google