1. More on neutral theory OEB 192 – 10.09.15

2. Example: Neighbor Joining (NJ) 4. Choose Methods Taxa Characters Species A ATGGCTATTCTTATAGTACG Species B ATCGCTAGTCTTATATTACA Species C TTCACTAGACCTGTGGTCCA Species D TTGACCAGACCTGTGGTCCG Species E TTGACCAGTTCTCTAGTTCG A B C D E Choose methods: distance-based A B C D E Species A ---- 4 10 9 8 Species B ---- 8 11 10 Species C ---- 3 8 Species D ---- 5 Species E ---- A B C D E Species A ---- 4 10 9 8 Species B -19.3 ---- 8 11 10 Species C -10 -14.7 ---- 3 8 Species D -10.7 -11.3 -16 ---- 5 Species E -12.7 -13.3 -12 -14.7 ---- M(AB)=d(AB) -[(r(A) + r(B))/(N-2)]

3. 4. Choose Methods Maximum Parsimony (MP): Model: Evolution goes through the least number of changes Maximum Likelihood (ML): L (data| model) Bayesian Inference Discrete character methods

4. 3. Choose Models Ancestral Sequences Observed Sequences ? Model Choose “model”

5. 5. Assess Reliability I. Bootstrap Re-sampling to produce pseudo-dataset (random weighting) II. Jacknife Sampling with replacement III. Permutation test Random deletion of sub-dataset Randomize dataset to build null likelihood distribution CGATCGTTA CAATGATAG CGCTGATAA CGCTGATCG taxa1 taxa2 taxa3 taxa4 123456789 Dataset1: 729338554 Dataset2: 631981282 … Dataset1: 1-3-56789 Dataset2: 12-45678- … 100 73 Assess reliability

6. 5. Assess Reliability Utility of phylogeny: Molecular clock (Korber et al., 2000)

7. 5. Assess Reliability Utility of phylogeny: Molecular clock (Korber et al., 2000)

8. 5. Assess Reliability Utility of phylogeny: Molecular clock (Hillis, 2000)

9. Utility of phylogeny: infer past environment? (Gaucher et al., 2003)

10. Molecular signs of selection (Sawyer & Malik, 2006)

11. Genetic exchange in bacteria/archaea

12. Monday (9/20): Horizontal gene transfer

13. Upcoming talks in microbial evolution… MSI Chalktalk Breakfast Friday, Sept 17 th 8:45-9:30 am “Time series analyses of the flora during enteric infections” Lynn Bry HMS Host: Colleen Cavanaugh Please join us for coffee/tea/pastries at 8:30 am - Directions to 24 Oxford St: http://www.msi.harvard.edu/ov_dir.htmlhttp://www.msi.harvard.edu/ov_dir.html - Join MSI-news listserv: Email: listserv@listserv.med.harvard.edu and in the body of your email, copy the text: subscribe msi-newslistserv@listserv.med.harvard.edu