Presentation is loading. Please wait.

Presentation is loading. Please wait.

Introduction to Bioinformatics

Similar presentations


Presentation on theme: "Introduction to Bioinformatics"— Presentation transcript:

1 Introduction to Bioinformatics
Sequence Alignments

2 Sequence Alignments Cornerstone of bioinformatics What is a sequence?
Nucleotide sequence Amino acid sequence Pairwise and multiple sequence alignments We will focus on pairwise alignments What alignments can help Determine function of a newly discovered gene sequence Determine evolutionary relationships among genes, proteins, and species Predicting structure and function of protein Intro to Bioinformatics – Sequence Alignment Acknowledgement: This notes is adapted from lecture notes of both Wright State University’s Bioinformatics Program and Professor Laurie Heyer of Davidson College with permission.

3 DNA Replication Prior to cell division, all the genetic instructions must be “copied” so that each new cell will have a complete set DNA polymerase is the enzyme that copies DNA Reads the old strand in the 3´ to 5´ direction Intro to Bioinformatics – Sequence Alignment

4 Over time, genes accumulate mutations
Environmental factors Radiation Oxidation Mistakes in replication or repair Deletions, Duplications Insertions, Inversions Translocations Point mutations Intro to Bioinformatics – Sequence Alignment

5 Deletions Codon deletion: ACG ATA GCG TAT GTA TAG CCG…
Effect depends on the protein, position, etc. Almost always deleterious Sometimes lethal Frame shift mutation: ACG ATA GCG TAT GTA TAG CCG… ACG ATA GCG ATG TAT AGC CG?… Almost always lethal Intro to Bioinformatics – Sequence Alignment

6 Indels Comparing two genes it is generally impossible to tell if an indel is an insertion in one gene, or a deletion in another, unless ancestry is known: ACGTCTGATACGCCGTATCGTCTATCT ACGTCTGAT---CCGTATCGTCTATCT Intro to Bioinformatics – Sequence Alignment

7 The Genetic Code Substitutions are mutations accepted by natural selection. Synonymous: CGC  CGA Non-synonymous: GAU  GAA Intro to Bioinformatics – Sequence Alignment

8 Comparing Two Sequences
Point mutations, easy: ACGTCTGATACGCCGTATAGTCTATCT ACGTCTGATTCGCCCTATCGTCTATCT Indels are difficult, must align sequences: ACGTCTGATACGCCGTATAGTCTATCT CTGATTCGCATCGTCTATCT ACGTCTGATACGCCGTATAGTCTATCT ----CTGATTCGC---ATCGTCTATCT Intro to Bioinformatics – Sequence Alignment

9 Why Align Sequences? The draft human genome is available
Automated gene finding is possible Gene: AGTACGTATCGTATAGCGTAA What does it do? One approach: Is there a similar gene in another species? Align sequences with known genes Find the gene with the “best” match Intro to Bioinformatics – Sequence Alignment

10 Gaps or No Gaps Examples Intro to Bioinformatics – Sequence Alignment

11 Scoring a Sequence Alignment
Given Match score: +1 Mismatch score: +0 Gap penalty: –1 Sequences ACGTCTGATACGCCGTATAGTCTATCT ||||| ||| || |||||||| ----CTGATTCGC---ATCGTCTATCT Matches: 18 × (+1) Mismatches: 2 × 0 Gaps: 7 × (– 1) Score = +11 Intro to Bioinformatics – Sequence Alignment

12 Origination and Length Penalties
Note that a bioinformatics computational model or algorithm must be “biologically meaningful” or even “biologically significant” We want to find alignments that are evolutionarily likely. Which of the following alignments seems more likely to you? ACGTCTGATACGCCGTATAGTCTATCT ACGTCTGAT ATAGTCTATCT ACGTCTGATACGCCGTATAGTCTATCT AC-T-TGA--CG-CGT-TA-TCTATCT We can achieve this by penalizing more for a new gap, than for extending an existing gap Intro to Bioinformatics – Sequence Alignment

13 Scoring a Sequence Alignment (2)
Given Match/mismatch score: +1/+0 Gap origination/length penalty: –2/–1 Sequences ACGTCTGATACGCCGTATAGTCTATCT ||||| ||| || |||||||| ----CTGATTCGC---ATCGTCTATCT Matches: 18 × (+1) Mismatches: 2 × 0 Origination: 2 × (–2) Length: 7 × (–1) Caution: Sometime “gap extension” used instead of “gap length” … Score = +7 Intro to Bioinformatics – Sequence Alignment

14 How can we find an optimal alignment?
Finding the alignment is computationally hard: ACGTCTGATACGCCGTATAGTCTATCT CTGAT---TCG-CATCGTC--T-ATCT C(27,7) gap positions = ~888,000 possibilities It’s possible, as long as we don’t repeat our work! Dynamic programming: The Needleman & Wunsch algorithm Intro to Bioinformatics – Sequence Alignment

15 Dynamic Programming Technique of solving optimization problems
Find and memorize solutions for subproblems Use those solutions to build solutions for larger subproblems Continue until the final solution is found Recursive computation of cost function in a non-recursive fashion Intro to Bioinformatics – Sequence Alignment

16 Dynamic Programming Example
Solving Fibonacci number f(n) = f(n-1) + f(n-2) recursively takes exponential time Because many numbers are recalculated Solving it using dynamic programming only takes a linear time Use an array f[] to store the numbers f[0] = 1; f[1] = 1; for (i = 2; i <= n; i++) f[i] = f[i – 1] + f[i – 2]; Intro to Bioinformatics – Sequence Alignment

17 Global Sequence Alignment
Needleman-Wunsch algorithm Suppose we are aligning: a with a … Di,j = max{ Di-1,j + d(Ai, –), Di,j-1 + d(–, Bj), Di-1,j-1 + d(Ai, Bj) } B i-1 j-1 j i A Seq1 Seq2 Intro to Bioinformatics – Sequence Alignment

18 Dynamic Programming (DP) Concept
Suppose we are aligning: CACGA CGA Intro to Bioinformatics – Sequence Alignment

19 DP – Recursion Perspective
Suppose we are aligning: ACTCG ACAGTAG Last position choices: G +1 ACTC G ACAGTA G -1 ACTC - ACAGTAG ACTCG G ACAGTA Intro to Bioinformatics – Sequence Alignment

20 What is the optimal alignment?
ACTCG ACAGTAG Match: +1 Mismatch: 0 Gap: –1 Intro to Bioinformatics – Sequence Alignment

21 Needleman-Wunsch: Step 1
Each sequence along one axis Gap penalty multiples in first row/column 0 in [1,1] (or [0,0] for the CS-minded) Intro to Bioinformatics – Sequence Alignment

22 Needleman-Wunsch: Step 2
Vertical/Horiz. move: Score + (simple) gap penalty Diagonal move: Score + match/mismatch score Take the MAX of the three possibilities Intro to Bioinformatics – Sequence Alignment

23 Needleman-Wunsch: Step 2 (cont’d)
Fill out the rest of the table likewise… Intro to Bioinformatics – Sequence Alignment

24 Needleman-Wunsch: Step 2 (cont’d)
Fill out the rest of the table likewise… The optimal alignment score is calculated in the lower-right corner Intro to Bioinformatics – Sequence Alignment

25 But what is the optimal alignment
To reconstruct the optimal alignment, we must determine of where the MAX at each step came from… Intro to Bioinformatics – Sequence Alignment

26 A path corresponds to an alignment
= GAP in top sequence = GAP in left sequence = ALIGN both positions One path from the previous table: Corresponding alignment (start at the end): AC--TCG ACAGTAG Score = +2 Intro to Bioinformatics – Sequence Alignment

27 Algorithm Analysis Brute force approach Dynamic programming
If the length of both sequences is n, number of possibility = C(2n, n) = (2n)!/(n!)2  22n / (n)1/2, using Sterling’s approximation of n! = (2n)1/2e-nnn. O(4n) Dynamic programming O(mn), where the two sequence sizes are m and n, respectively O(n2), if m is in the order of n Intro to Bioinformatics – Sequence Alignment

28 Practice Problem Find an optimal alignment for these two sequences: GCGGTT GCGT Match: +1 Mismatch: 0 Gap: –1 Intro to Bioinformatics – Sequence Alignment

29 Practice Problem Find an optimal alignment for these two sequences: GCGGTT GCGT GCGGTT GCG-T- Score = +2 Intro to Bioinformatics – Sequence Alignment

30 Semi-global alignment
Suppose we are aligning: GCG GGCG Which do you prefer? G-CG -GCG GGCG GGCG Semi-global alignment allows gaps at the ends for free. Terminal gaps are usually the result of incomplete data acquisition  no biologically significant Intro to Bioinformatics – Sequence Alignment

31 Semi-global alignment
Semi-global alignment allows gaps at the ends for free. Initialize first row and column to all 0’s Allow free horizontal/vertical moves in last row and column Intro to Bioinformatics – Sequence Alignment

32 Local alignment Global alignments – score the entire alignment
Semi-global alignments – allow unscored gaps at the beginning or end of either sequence Local alignment – find the best matching subsequence CGATG AAATGGA This is achieved by allowing a 4th alternative at each position in the table: zero. Intro to Bioinformatics – Sequence Alignment

33 Local Sequence Alignment
Why local sequence alignment? Subsequence comparison between a DNA sequence and a genome Protein function domains Exons matching Smith-Waterman algorithm Initialization: D1,j = , Di,1 =  Di,j = max{ Di-1,j + d(Ai, –), Di,j-1 + d(–,Bj), Di-1,j-1 + d(Ai,Bj), 0 } Intro to Bioinformatics – Sequence Alignment

34 Local alignment Score: Match = 1, Mismatch = -1, Gap = -1
1 2 3 CGATG AAATGGA Intro to Bioinformatics – Sequence Alignment

35 Local alignment Another example
Intro to Bioinformatics – Sequence Alignment

36 More Example Align Global Alignment: ATGGCCTC ACGGC-TC ATGGCCTC
Mismatch  = -3 Gap  = -4 -- A C G T -- A T G C -4 -8 -12 -16 -20 -24 -28 -4 -8 -12 -16 -20 -24 -28 -32 -7 -11 -15 -19 -23 -2 -6 -10 -14 -18 -1 -5 -9 -13 -17 -4 -8 -12 1 -3 -27 -22 -21 -16 1 -3 Global Alignment: ATGGCCTC ACGGC-TC Intro to Bioinformatics – Sequence Alignment

37 More Example Local Alignment: ATGGCCTC ACGG CTC or ACGGC TC -- A C G T
1 2 3 1 Intro to Bioinformatics – Sequence Alignment

38 Scoring Matrices for DNA Sequences
Transition: A  G C  T Transversion: a purine (A or G) is replaced by a pyrimadine (C or T) or vice versa Intro to Bioinformatics – Sequence Alignment

39 Scoring Matrices for Protein Sequence
PAM 250 Intro to Bioinformatics – Sequence Alignment

40 Scoring Matrices for Protein Sequence
PAM (Percent Accepted Mutations) 1 PAM unit can be thought of as the amount of time in which an “average” protein mutates 1 out of every 100 amino acids. Perform multiple sequence alignment on a “family” of proteins that are at least 85% similar. Find the frequency of amino acid i and j are aligned to each other and normalize it. Entry mij in PAM1 represents the probability of amino acid i substituted by amino acid j in 1 PAM unit PAM 2 = PAM 1 × PAM 1 PAM n = (PAM 1)n, e.g., PAM 250 = (PAM 1)250 Questions Why are values in a PAM matrix integers? Shouldn’t a probability be between 0 and 1? Why is PAM250 possible? Shouldn’t a probability be less than or equal to 100%? Intro to Bioinformatics – Sequence Alignment

41 Scoring Matrices for Protein Sequence
BLOSUM (BLOcks SUbstitution Matrix) 62 Intro to Bioinformatics – Sequence Alignment

42 Using Protein Scoring Matrices
Divergence BLOSUM 80 BLOSUM 62 BLOSUM 45 PAM 1 PAM PAM 250 Closely related Distantly related Less divergent More divergent Less sensitive More sensitive Looking for Short similar sequences → use less sensitive matrix Long dissimilar sequences → use more sensitive matrix Unknown → use range of matrices Comparison PAM – designed to track evolutionary origin of proteins BLOSUM – designed to find conserved regions of proteins Intro to Bioinformatics – Sequence Alignment

43 Multiple Sequence Alignment
Why multiple sequence alignment (MSA) Two sequences might not look very similar. But, some “similarity” emerges with more sequences, however. Is dynamic programming still applicable? CLUSTALW One of most popular tools for MSA Heuristic-based approach Basic 1) Calculate the distance matrix based on pairwise alignments 2) Construct a guide tree NJ (unrooted tree)  Mid-point (rooted tree) 3) Progressive alignment using the guide tree


Download ppt "Introduction to Bioinformatics"

Similar presentations


Ads by Google