Presentation is loading. Please wait.

Presentation is loading. Please wait.

Sequencing Informatics Gabor T. Marth Department of Biology, Boston College BI420 – Introduction to Bioinformatics.

Similar presentations


Presentation on theme: "Sequencing Informatics Gabor T. Marth Department of Biology, Boston College BI420 – Introduction to Bioinformatics."— Presentation transcript:

1 Sequencing Informatics Gabor T. Marth Department of Biology, Boston College marth@bc.edu BI420 – Introduction to Bioinformatics

2 The nuclear genome (chromosomes)

3 The genome sequence the primary template on which to outline functional features of our genetic code (genes, regulatory elements, secondary structure, tertiary structure, etc.)

4 Completed genomes ~1 Mb ~100 Mb >100 Mb ~3,000 Mb

5 Main genome sequencing strategies Clone-based shotgun sequencing Whole-genome shotgun sequencing Human Genome ProjectCelera Genomics, Inc.

6 Hierarchical genome sequencing BAC library construction clone mapping shotgun subclone library construction sequencing sequence reconstruction (sequence assembly) Lander et al. Nature 2001

7 Clone mapping – “sequence ready” map

8 Hierarchical genome sequencing BAC library construction clone mapping shotgun subclone library construction sequencing/read processing sequence reconstruction (sequence assembly) Lander et al. Nature 2001

9 Shotgun subclone library construction BAC primary clone cloning vector sequencing vector subclone insert

10 Hierarchical genome sequencing BAC library construction clone mapping shotgun subclone library construction sequencing/read processing sequence reconstruction (sequence assembly) Lander et al. Nature 2001

11 Sequencing

12 Robotic automation Lander et al. Nature 2001

13 Base calling GGGCTCAGCTGTATCAGCCACGTGCCTACAACAATCTGCCCCT

14 Base calling PHRED base = A Q = 40

15 Vector clipping

16 Hierarchical genome sequencing BAC library construction clone mapping shotgun subclone library construction sequencing/read processing sequence reconstruction (sequence assembly) Lander et al. Nature 2001

17 Sequence assembly PHRAP

18 Repetitive DNA may confuse assembly

19 Sequence completion (finishing) CONSED, AUTOFINISH gap region of low sequence coverage and/or quality

20 New sequencing technologies From familiar ABI traces … … and Solexa reads.… to 454 pyrograms … 100 x 1,000 bp 100 thousand x 100 bp 50 million x 20 bp


Download ppt "Sequencing Informatics Gabor T. Marth Department of Biology, Boston College BI420 – Introduction to Bioinformatics."

Similar presentations


Ads by Google