Presentation is loading. Please wait.

Presentation is loading. Please wait.

Ch 17 Gene Expression II: Translation mRNA->Protein

Published by Modified over 9 years ago

Similar presentations

Presentation on theme: "Ch 17 Gene Expression II: Translation mRNA->Protein"— Presentation transcript:

1 Ch 17 Gene Expression II: Translation mRNA->Protein

2 Review DNA RNA Protein LE 17-4 Gene 2 DNA molecule Gene 1 Gene 3
DNA strand (template) 3¢ 5¢ TRANSCRIPTION RNA mRNA 5¢ 3¢ Codon TRANSLATION Protein Protein Amino acid

3 Review DNA RNA Protein LE 17-4 Gene 2 DNA molecule Gene 1 Gene 3
DNA strand (template) 3¢ 5¢ TRANSCRIPTION RNA mRNA 5¢ 3¢ Codon TRANSLATION Protein Protein Amino acid

4 Cracking the Code 64 codons Genetic code Codons
decoded by the mid-1960s Genetic code redundant but not ambiguous; no codon specifies more than one amino acid (but one amino acid may have >1 codon) Codons must be read in the correct reading frame in order for the specified polypeptide to be produced

5 Codon Table Genetic Code LE 17-5 Second mRNA base
First mRNA base (5¢ end) Third mRNA base (3¢ end)

6 Find an example of redundancy in the genetic code.
Which amino acid does not have redundant codons? Is there a pattern to redundant codons?

7 Evolution of the Genetic Code
nearly universal: shared by the simplest bacteria, plants, fungi and animals Genes can be transcribed and translated after being transferred from one species to another

8 Mechanism of Translation
Ribosomes - Bind messenger (mRNA) - Attract transfer RNA (tRNA) to mRNA - tRNA covalently linked to specific amino acid (aa-tRNA) Complementary basepairs form between mRNA and aa-tRNA (codon-anticodon interactions) Enzyme in ribosome catalyzes peptide bond between amino acids -> polypeptide chain grows

9 tRNA structure ~ 80 nt long Three different schematics
LE 17-14a tRNA structure 3¢ Amino acid attachment site 5¢ ~ 80 nt long Three different schematics Hydrogen bonds In what ways do they convey the same and different information? Anticodon Two-dimensional structure Amino acid attachment site 5¢ 3¢ Hydrogen bonds 3¢ 5¢ Anticodon Anticodon Three-dimensional structure Symbol used in this book

10 LE 17-13 Amino acids Polypeptide tRNA with amino acid attached Ribosome tRNA Anticodon 5¢ Codons 3¢ mRNA

11 Accurate translation requires two steps
a correct match between tRNA and an amino acid - Catalyzed by aminoacyl-tRNA synthetase 2. a correct match between the tRNA anticodon and an mRNA codon

12 1. Amino acid Aminoacyl-tRNA synthetase (enzyme) Pyrophosphate
LE 17-15 Amino acid Aminoacyl-tRNA synthetase (enzyme) 1. Pyrophosphate Phosphates tRNA AMP Aminoacyl tRNA (an “activated amino acid”)

13 Ribosomes Draw Facilitate specific coupling of anticodons with codons
Ribosomal structure Two ribosomal subunits (large and small) Made of proteins (ribosomal proteins) and ribosomal RNA (rRNA) Form binding sites for mRNA and aa-tRNA Draw

14 Computer model of functioning ribosome
LE 17-16a Exit tunnel Growing polypeptide tRNA molecules Large subunit E P A Small subunit 5¢ mRNA 3¢ Computer model of functioning ribosome

15 Schematic model showing binding sites on ribosome
LE 17-16b Schematic model showing binding sites on ribosome P site (Peptidyl-tRNA binding site) A site (Aminoacyl- tRNA binding site) E site (Exit site) E P A Large subunit mRNA binding site Small subunit

16 Ribosome translates 5’ to 3’ on mRNA.
LE 17-16c Amino end Growing polypeptide Next amino acid to be added to polypeptide chain E tRNA mRNA 3¢ Codons 5¢ Schematic model with mRNA and tRNA Ribosome translates 5’ to 3’ on mRNA. Polypeptide chain grows amino end first, carboxyl end last.

17 Building a Polypeptide
The three stages of translation: Initiation Elongation Termination All three stages require protein translation factors

18 Ribosome Association and Initiation of Translation
Small ribosomal subunit binds mRNA and special initiator tRNA (met-tRNAi) (carries the amino acid methionine) 2. Small subunit scans along the mRNA until first start codon (AUG). 3. Initiation factors bring in large subunit initiator tRNA occupies the P site.

19 Codon Table Genetic Code Memorize Start Codon LE 17-5 Second mRNA base
First mRNA base (5¢ end) Third mRNA base (3¢ end)

20 Met Met GTP GDP E A 5¢ 5¢ 3¢ 3¢ Large ribosomal subunit P site
LE 17-17 Large ribosomal subunit P site Met Met Initiator tRNA GTP GDP E A mRNA 5¢ 5¢ 3¢ 3¢ Start codon Small ribosomal subunit mRNA binding site Translation initiation complex

21 Elongation of the Polypeptide Chain
- Amino acids are added one by one to the preceding amino acid Elongation factors facilitate codon recognition peptide bond formation translocation

22 1. Recognition 3. Translocation 2. Peptide bond formation LE 17-18
Amino end of polypeptide E 3¢ mRNA P site A site Ribosome ready for next aminoacyl tRNA 5¢ 2 GTP 2 GDP E E P A P A GDP GTP 3. Translocation 2. Peptide bond formation E P A

23 Termination of Translation
- Occurs when stop codon in mRNA reaches A site of ribosome - A site accepts protein called release factor Release factor causes addition of water molecule instead of amino acid - Polypeptide released, ribosomal subunits dissociate and fall off mRNA

24 Codon Table Genetic Code Memorize Stop Codons LE 17-5 Second mRNA base
First mRNA base (5¢ end) Third mRNA base (3¢ end)

25 3¢ 3¢ 5¢ LE 17-19 Release factor Stop codon (UAG, UAA, or UGA) Free
polypeptide When a ribosome reaches a stop codon on mRNA, the A site of the ribosome accepts a protein called a release factor instead of tRNA. 3¢ The release factor hydrolyzes the bond between the tRNA in the P site and the last amino acid of the polypeptide chain. The polypeptide is thus freed from the ribosome. The two ribosomal subunits and the other components of the assembly dissociate.

26 5’ cgaggucaaugcccuauguuuagccc 3’
Let’s translate a mRNA… 5’ cgaggucaaugcccuauguuuagccc 3’ Bracket each codon in the open reading frame (ORF). Write the amino acid below each codon. What is the anticodon for the second codon in the ORF?

27 3’ 5’ I’m complicated but once you get to know me
I’m really pretty nice. Any questions? 3’ 5’

28 Can a transcript (mRNA) be translated by multiple
ribosomes simultaneously?

29 Polyribosomes -a single mRNA (transcript) is translated by many ribosomes simultaneously mRNA+ bound ribosomes= polyribosomes or polysome Allows fast synthesis of many copies a polypeptide

30 Polyribosome or Polysome LE 17-20 Completed polypeptides Growing
Incoming ribosomal subunits Polyribosome Start of mRNA (5¢ end) End of mRNA (3¢ end) An mRNA molecule is generally translated simultaneously by several ribosomes in clusters called polyribosomes. Ribosomes mRNA 0.1 mm This micrograph shows a large polyribosome in a prokaryotic cell (TEM).

31 Consider: When a eukaryotic message is transcribed, processed and transported to the cytosol, is it immediately translated into protein? When would a cell need a polypeptide immediately? When would a cell want to delay translation? Examples? What strategy could one use to determine whether a mRNA was being actively translated? Hint: consider mass Subject cell homogenate to differential centrifugation -Heavy polysomes will pellet -Light untranslated mRNA in supernatant

32 Where and when are transcripts translated in prokaryotes?
Polysomes in Prokaryotes Where and when are transcripts translated in prokaryotes? Coupled transcription and translation

33 RNA polymerase DNA mRNA Polyribosome Direction of transcription
LE 17-22 RNA polymerase DNA mRNA Polyribosome Direction of transcription 0.25 mm RNA polymerase DNA Polyribosome Polypeptide (amino end) Ribosome mRNA (5¢ end)

34 Targeting Polypeptides to Specific Locations
In eukaryotes, what are the two populations of ribosomes? Free, soluble in cytosol synthesize soluble proteins Bound to rER - synthesize secreted or membrane bound proteins - tagged with signal peptide at amino end

35 Signal peptide targets polypeptides to ER
LE 17-21 Signal peptide targets polypeptides to ER final polypeptide destined for secretion or membrane Ribosomes mRNA Signal peptide ER membrane Signal- recognition particle (SRP) Signal peptide removed Protein SRP receptor protein CYTOSOL ER LUMEN Translocation complex Is the molecular weight of a secreted protein different than the predicted translation product of its mRNA?

36 Effect of mutations on gene expression
What is a mutation? Any change in the genetic material of a cell or virus Types of mutations Point: a single nucleotide change -substitution gcca->gcga -deletion gcca->gca -insertion gcca->gacca Also, breaks, translocations, inversions as reviewed previously

37 Translate into protein
LE 17-23 What kind of mutation? substitution Wild-type hemoglobin DNA Mutant hemoglobin DNA 3¢ 5¢ 3¢ 5¢ mRNA 5¢ 3¢ Transcribe into mRNA Translate into protein Normal hemoglobin Sickle-cell hemoglobin

38 Codon Table Genetic Code Memorize Start Codon LE 17-5 Second mRNA base
First mRNA base (5¢ end) Third mRNA base (3¢ end)

39 Missense mutations are more common. Why?
Substitutions Missense mutations Change codon to encode a different amino acid Nonsense mutations Change codon to encode a stop codon nearly always leading to a nonfunctional protein Missense mutations are more common. Why?

40 Substitutions Neutral Change in amino acid Premature termination
LE 17-24 Wild type mRNA 5¢ 3¢ Protein Stop Amino end Carboxyl end Base-pair substitution No effect on amino acid sequence U instead of C Substitutions Neutral Stop Missense A instead of G Change in amino acid Stop Nonsense U instead of A Premature termination Stop

41 Insertions and Deletions
Alters reading frame ->frameshift mutation Often more devastating than substitutions

42 LE 17-25 Wild type mRNA 5¢ 3¢ Protein Stop Amino end Carboxyl end Base-pair insertion or deletion Addition frameshift Extra U Stop Deletion frameshift Missing Insertion or deletion of 3 nucleotides Missing Stop

43 Source of Mutations From spontaneous mutations: occur during DNA replication, recombination, or repair From mutagens are physical or chemical agents that can cause mutations

44 What is a gene? revisiting the question
A gene is a region of DNA whose final product is either a polypeptide or an RNA molecule

45 LE 17-26 TRANSCRIPTION DNA 3¢ 5¢ RNA transcript RNA polymerase
RNA PROCESSING Exon RNA transcript (pre-mRNA) Intron Aminoacyl-tRNA synthetase NUCLEUS FORMATION OF INITIATION COMPLEX Amino acid CYTOPLASM AMINO ACID ACTIVATION tRNA mRNA Growing polypeptide Activated amino acid 3¢ A P E Ribosomal subunits 5¢ TRANSLATION E A Anticodon Codon Ribosome

Download ppt "Ch 17 Gene Expression II: Translation mRNA->Protein"

Similar presentations

Both are nucleic acids… Be able to compare these two nucleic acids.

Both are nucleic acids… Be able to compare these two nucleic acids.
Protein Synthesis The genetic code – the sequence of nucleotides in DNA – is ultimately translated into the sequence of amino acids in proteins – gene.

Protein Synthesis The genetic code – the sequence of nucleotides in DNA – is ultimately translated into the sequence of amino acids in proteins – gene.
Chapter 17 From Gene to Protein.

Chapter 17 From Gene to Protein.
12 From DNA to Protein: Genotype to Phenotype. 12 One Gene, One Polypeptide A gene is defined as a DNA sequence that encodes information. In the 1940s,

12 From DNA to Protein: Genotype to Phenotype. 12 One Gene, One Polypeptide A gene is defined as a DNA sequence that encodes information. In the 1940s,
From Gene To Protein Chapter 17. The Connection Between Genes and Proteins Proteins - link between genotype (what DNA says) and phenotype (physical expression)

From Gene To Protein Chapter 17. The Connection Between Genes and Proteins Proteins - link between genotype (what DNA says) and phenotype (physical expression)
https://www. google. com/search

google. com/search
Gene Expression Chapter 13.

Gene Expression Chapter 13.
Chapter 6 Expression of Biological Information (Part IV)

Chapter 6 Expression of Biological Information (Part IV)
Chapter 17 From Gene to Protein.

Chapter 17 From Gene to Protein.
RNA and Protein Synthesis

RNA and Protein Synthesis
AP Biology Ch. 17 From Gene to Protein.

AP Biology Ch. 17 From Gene to Protein.
Protein Synthesis-Translation Warm-up #6 1.How is RNA different than DNA? 2.Name the 3 steps of transcription. 3.What is the end product of transcription?

Protein Synthesis-Translation Warm-up #6 1.How is RNA different than DNA? 2.Name the 3 steps of transcription. 3.What is the end product of transcription?
Ch 17 part 1 Protein Synthesis (Translation). How does an mRNA molecule produce a protein?

Ch 17 part 1 Protein Synthesis (Translation). How does an mRNA molecule produce a protein?
Protein Synthesis: Ch 17 From : Kevin Brown – University of Florida

Protein Synthesis: Ch 17 From : Kevin Brown – University of Florida
Gene to protein The two main processes that link the gene to protein are: RNA transcription and translation. The bridge between DNA and protein synthesis.

Gene to protein The two main processes that link the gene to protein are: RNA transcription and translation. The bridge between DNA and protein synthesis.
From Gene to Protein Transcription – the synthesis of RNA from the DNA template –messenger RNA (mRNA) – carries a genetic message from the DNA in the.

From Gene to Protein Transcription – the synthesis of RNA from the DNA template –messenger RNA (mRNA) – carries a genetic message from the DNA in the.
Transcription Translation

Transcription Translation
Chapter 17 From Gene to Protein

Chapter 17 From Gene to Protein
Fig. 17-5 Second mRNA base First mRNA base (5 end of codon) Third mRNA base (3 end of codon)

Fig Second mRNA base First mRNA base (5 end of codon) Third mRNA base (3 end of codon)
PROTEIN SYNTHESIS. Protein Synthesis: overview  DNA is the code that controls everything in your body In order for DNA to work the code that it contains.

PROTEIN SYNTHESIS. Protein Synthesis: overview  DNA is the code that controls everything in your body In order for DNA to work the code that it contains.

Similar presentations

Ads by Google