1. 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Load organisms from green house.

2. 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Click “open”

3. 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON

4. 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Select an organism for self cross for eg. The Red organism Then click tab “Self-cross One Organism”

5. 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Resulting offsprings of Red organism. Then double click on Tray1 and click “Send to Lower Panel”

6. 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Select two different organisms(heterozygous)‏ Then click the tab “Cross Two Organisms”

7. 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Resulting offsprings of Red and Green-1 organism.

8. 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Select two same organisms(homozygous)‏ Then click the tab “Cross two Organisms”

9. 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Resulting offsprings of Red organism.

10. 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Select an organism Then click “Mutate One Organism”

11. 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON

12. 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Mutant versions of Green-2 organism. Then click the tab “Biochemistry”.

13. 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON In the Biochemistry add amino acid sequence SSSSSSS here. Then click “FOLD” Corresponding phenotype populated when sequence is folded. The default phenotype History List is populated with corresponding template and phenotype.-White organism

14. 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Enter another sequence FFFFFFF and click “FOLD” Corresponding phenotype(Red)‏ ‏ Heterozygous combined phenotype(Red)‏

15. 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Enter the same sequence FFFFFFF here and click “FOLD” Homozygous combined phenotype.(Red )‏

16. 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Then click tab “Molecular Biology”

17. 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Click the tab “Enter New DNA” Then enter the DNA sequence- TATAAATGTCTAATCGTCATATTTT ATTAGTTTTTTGTCGTCAATAGGGGGG and click “OK”

18. 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Then click “Fold Protein”

19. 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Resulting Organism -Red Default Phenotype

20. 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Double click “History List” and select “Send to Lower Panel” or Enter the same DNA by clicking “Enter New DNA” in Lower panel.

21. 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON The same two DNA sequences give the combined phenotype here(Red) which is homozygous.

22. 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Enter DNA- CAGCTATAACCGAGATTGATGTCTAGTGCGATAAGCCCCAAAGATCGGCACATTTTGTG CGCTATACAAAGGTTAGTGTACTGGCGGCAGTAGTAGGGGGCGT and click “OK”

23. 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Click “Fold Protein”

24. 24 April, 2008MGX TUTORIAL MGX © 2007-2008 UMASS BOSTON Resulting Green-1 organism The two different DNA sequences gives a Heterozygous combined phenotype which populates here.