1. Final Final: 2 of the following 3 choices, –1 hour exam covering recent materials, –2 page review of an assigned paper (due June 11), –Self-study of a remaining chapter in the text, answers to the “odd” problems.

2. How are we different? …at the DNA level.

3. Southern Analysis DNA hybridizing to DNA,

4. DNA Polymorphisms …a DNA locus that has two or more sequence variations, each present at a frequency of 1% or more in a population, –1 in 700 frequency common in most species, –less than 1 million loci in humans (1 in 3000). five classes of polymorphisms.

5. Polymorphisms Single Base Pair Differences, Microsatellites (short sequence repeats), Minisatellites (long sequence repeats), Deletions, Duplications.

6. Single Base Differences 5 ’ -------G-A-A-T-T-C--------3 ’ | | | | | | 3 ’ -------C-T-T-A-A-G--------5 ’ 5 ’ -------G-A-G-T-T-C--------3 ’ | | | | | | 3 ’ -------C-T-C-A-A-G--------5 ’ A to G mutation …point mutations, 98% of all mutations (1 in 200 bp).

7. Point Mutations Chemical Mutagens, UV-light, other natural and synthetic causes.

8. Detecting Point Mutations Direct DNA Sequencing, RFLP analysis, Alleles Specific Oligonucleotides...

9. Allele-Specific Oligonucleotides …short synthetic DNA probes able to differentiate between sequences differing by as little as 1 base pair, --AGTAGCTGTAGCT-- --TCATCGACATCGA-- Probe with fluorescent or radioactive CTPs. Complementary, binding. --AGTAGCTaTAGCT-- --TCATCGACATCGA-- mismatch no binding

10. Hybridization …the process of joining two complementary strands of DNA together,...or one DNA strand to an RNA strand, …molecular probes are hybridized to complementary strands, –probe/target complexes are made visible by fluorescence or radioactivity.

11. ASO and PCR …subject gene is amplified using PCR, …bound to a solid substrate, …probed with ASOs.

12. Put DNA on filter, probe with the ASO.

13. Microsattelites …DNA element composed of 15-100 tandem repeats of one-, two- or three base sequences, AAAAAAAAAAAAAAAAAAAAAAAAAAA CACACACACACACACACACACACACACA CATCATCATCATCATCATCATCATCATCAT

14. Microsattelite Details...also termed simple sequence repeats (SSRs), –1 in 30,000 bp, –100,000 microsattelites in humans, new alleles arise at an average rate of 10 -3 per locus, –higher than background mutation rate (10 -5 ), –at 1/1000, doesn’t occur too often.

15. DNA Polymerase Slippage replication incorporates repeats... replications

16. Minisattelites …DNA element composed of longer (10-80 bp) tandem repeating units of identical sequence, …variable number of tandem repeats (VNTRs), –often result in polymorphic region ranging from 1 to 15 kb in length,...approximately 1000 per human genome.

17. Unequal Crossing Over...minisattelite mutation frequency, 10 -3.

18. Deletions, Duplications, etc. …single base pair up to many megabase deletions or duplications, – cause by mutagens, or unequal crossing over, –extremely rare, infrequent in the genome.

19. Detecting Polymorphisms RFLPs Classical: restriction fragment length polymorphisms, –Advantage: don’t need sequence information, –Disadvantage: need lots of DNA and radioactive detection, labor and time dependent, –Major Use: genotyping in absence of sequence info.

20. Detecting Polymorphisms RFLPs PCR: restriction fragment length polymorphisms, –Advantage: don’t need lots of DNA or radioactivity, –Disadvantage: labor, time dependent, –Major Use: genotyping.

21. Detecting Polymorphisms ASOs: allele specific oligonucleotides, –Advantage: can detect single base pair changes, not dependent on specific palindromic sequences, –Disadvantage: must know wild-type sequence, and sequence of alternative alleles, –Major Use: genotyping.

22. Microsattelite Detection …one-, two- or three- base pair repeats, …need sequence information from both sides of the microsattelite to make PCR primers, …gel electrophoresis distinguishes differences in DNA length as small as two base pairs.

25. Minisattelite Detection …DNA element composed of longer (10-80 bp) tandem repeating units of identical sequence, –often result in polymorphic region ranging from 1 to 15 kb in length, –PCR now routinely amplifies templates up to 30 kb, analysis of minisattelites is similar to that of microsattelites.

26. Use of multiple loci provides a definite DNA fingerprint.

27. Micro-, Minisattelites Advantages: –provide detailed DNA fingerprints for genotyping, –specifically useful for differentiating family members and forensic work, Disadvantages: –requires sequence information and sophisticated statistical analysis.

28. RAPDs …random amplification of polymorphic DNA;...the use of non-specific DNA sequences to describe a specific genome.

29. RAPD Premise …short oligos of any sequence will find complementary sequences in some part of the genome, …if two of these target sequences are correctly oriented and close enough together for PCR, a fragment will be produced.

30. RAPD Primers Short in length, usually 10-mers, randomly selected, for example... – 5 ’ - agtcacgcag - 3 ’ occurs approximately every 1,000,000 base pairs, so in the human genome should bind at >3000 loci.

31. Random Distribution …this experiment would generate three PCR products.

33. RAPDs Advantages: –no requirement for sequence information, –great for genomes that are not well characterized, can sequence bands directly, gaining insight into polymorphic regions of uncharacterized species, Disadvantages: –provides information for random loci only.

34. Deletions, Duplications …rare events, –karyotyping, –SSCPs, –PCR (look for product size differences), –direct sequencing of DNA, –etc.

35. SSCPs...Single-Strand Conformation Polymorphisms:...gel electrophoresis detection of nucleotide differences in single stranded DNA molecules,... folding of single stranded DNA differs when there are base pair differences, …single stranded DNA migration through gel is partially dependent on the molecule’s conformation.

37. SSCPs Advantages: –can screen large numbers of individuals for mutated genes without direct sequencing, –can detect differences between wild-type and mutant genes at all base pairs, –don’t need to know sequence of mutant alleles, Disadvantage: –90% maximum detection rate.

38. Genetic Disease Detection RFLPs, ASOs, other PCR protocols, …determine genotypes that result in diseases directly,

39. ASO Pave Way for DNA-Chips …the next big thing, huge arrays of DNA for complex genotype and phenotype analysis, –B-Chip (Before chips), –A-Chips (After chips.

40. DNA Arrays …DNA systematically arrayed at high density, –virtual genomes for expression studies, RNA hybridization to DNA for expression studies, –comparative genomics, DNA hybridization to DNA, –inter- and intra-species comparisons, etc. –potential yet to be developed.

41. Arrays solid substrate DNA Chip: oligonucleotides, up to 1000s kb fragments.

42. Probes/Targets...Probes: are the tethered nucleic acids with known sequence, –the DNA on the chip,...Target: is the free nucleic acid sample whose identity/abundance is being detected, –the labeled nucleic acid that is washed over the chip.

43. DNA-Probes –cDNA arrays, DNA arrays, DNA Microarrays, –oligonucleotide arrays, DNA chips. nucleic acid is spotted onto the substrate. nucleic acid is synthesized directly onto on the substrate.

44. DNA Chips …oligonucleotides systematically synthesized in situ at high density. Affymetrix DNA Chip

45. Allele-Specific Oligonucleotides (DNA Chips) …allele specific oligonucleotides (ASOs) recognize single base pair differences in DNA sequences. --AGTAGCTGTAGCT-- --TCATCGACATCGA-- --AGTAGCTaTAGCT-- --TCATCGACATCGA-- mismatch no binding

46. Ordered Array of ASOs linker molecule...over a million ASOs and controls can be gridded per cm 2.

47. Photolithography …the process of using an optical image and a photosensitive substrate to produce a pattern, oligonucleotide synthesis can be inhibited by a ‘protection group’ molecule, the ‘protection group’ can be linked by a photosensitive bond, and thus cleaved by light.

50. Targets...fluorescent targets, –genomic DNA, –cDNA, mRNA or cRNA for expression studies, …targets are washed over the chip for hybridization.

51. cDNA Microarrays...denatured, double stranded DNA (500 - 5000 bp) is dotted, or sprayed on a glass or nylon substrate,...up to tens of thousands of spots per array, quill technology...

52. Hybridization Detection …fluorescent images are read by an optical scanner, and intensities are compared using algorithms to differentiate artifacts.

53. DNA ChipDNA Microarray Probe? Target? Oligos mRNA Transcripts Under Two Conditions. Probe?cDNAs

54. Screening for Genetic Disease Cystic fibrosis: 75% of mutations are at the  508 deletion site, –8% are in three additional specific locations in the gene, the rest are spread across the length of the gene, Pre-Array tests yielded only an ~83% chance of detecting a mutation.

55. Cystic fibrosis Detection Create a DNA chip with ASOs for wild- type Cystic fibrosis gene, –approximately 4.5 kb of the 250 kb gene codes for the structural portion of the gene, 225 20-mers span 4.5 kb, 20 mismatches per 20-mer requires 4500 ASOs, or grids, plus controls.

56. Creating the Mask …computer algorithms are used to design the mask, –creation of mask is now the limiting process, requires months to accomplish, and about $100,000 per mask, –masks have limited lifetimes, each array costs about $100 currently.

57. Cystic fibrosis Chip …using photlithography, create a chip with ASOs to identify any difference from wild- type DNA, …match results with mutations at know deleterious loci, …catalog new deleterious loci.

58. 1 Gene of Many …with controls, the Cystic fibrosis gene may require up to 20,000 grids, …new chips can accommodate up to 1 million grids, …can look at 50 similarly sized genes on one chip.

59. 4000 + Genetic Diseases …as genes are linked to diseases, quick, inexpensive tests can be performed to determine who carries specific mutations, …computer analysis will provide genome profiles that predict a variety of traits.

61. Genome Profiling …with 1500 SNPs now, and up to thousands available, genetic profiles can be made, …choose SNPs in or near genes involved in traits or diseases, …compare profiles over large populations.

62. How are we different? …at the RNA level.

63. Northern Analysis DNA hybridizing to DNA,

64. DNA Arrays and Expression …grid gene-specific ASOs onto the DNA chip, or cDNAs onto microarrays, …probe with labeled cDNA, genes that are expressed at a specific time, place or under a specific condition will bind to the chip for display.

66. Genes and Targets once the Human Genome Project is done, all of the genes can be gridded, –presently, several completely sequenced genomes have been gridded, yeast, E. coli, various bacteria, drug identification, fundamental research, etc.,

69. Applications Monitor expression patterns under the experimental conditions of your choosing to determine the function of the thousands genes, Common expression patterns can be used to identify genes that are members of the same pathway, Explore expression of candidate/unknown genes.

70. Gene/Drug Discovery …genes involved in cancer and other diseases have been identified through a variety of techniques, …genome expression analysis provides a means of discovering other genes that are concomitantly expressed.

72. Applications Can study the role of more than 1700 cancer related genes in association with the (rest) of the genome, Define interactions and describe pathways, Measure drug response, Build databases for use in molecular tumor classifications, –benign vs. cancerous, slow vs. aggressive

73. Extended Applications Water quality testing (4 hours vs. 4 days), Environmental watchdogs, Fundamental research on non-human subjects, Direct sequencing of related species for evolutionary studies, etc.

74. Friday Intra- and Interspecies Variation in Primate Gene Expression Patterns Background: Review of DNA Arrays