1. Global dissection of cis and trans regulatory variations in Arabidopsis thaliana Xu Zhang Borevitz Lab

2. Col and Van are collected from distinct geographic locations

3. Expression regulatory variation can act in cis or in trans cis polymorphism gene 1 gene 2 gene 3 trans polymorphism regulator 1 regulator 2

4. eQTL mapping in segregating populations  CAUSAL cis and trans variation can be mapped individually  Additive effects and non-additive interactions among the eQTL can be assessed  limited detection power due to the sample size and extent of recombination of mapping population; it actually maps LOCAL and DISTANT variation Dissection of cis and trans variation

5. Allele specific expression in a heterozygous system allele A allele B Allele A and B are exposed to the same pool of trans factors. Thus allelic expression should be due to cis difference within or nearby the gene

6. Col Van hybrids Composite trans effects are inferred by comparison of hybrids and parents cis effect trans effect expression level

7. Allele specific expression in a heterozygous system  closely locates cis causal variation  composite effect of trans variation can be inferred by testing the deviation of allelic expression in heterozygous from the differential expression between homozygous parents  individual causal loci can NOT be mapped, their interaction can NOT be assessed Dissection of cis and trans variation

8. Van ♀ x Van ♂ Col ♀ x Van ♂ Van ♀ x Col ♂  4 replicates for parental gDNA1:1 mix  4 replicates for parental mRNA1:1 mix  4 replicates for Col (mother) x Van F1s  4 replicates for Van (mother) x Col F1s Biological samples for microarray hybridization Col ♀ x Col ♂

9. cis and trans The measurement: allele intensity ratio of the transcript – Col allele/Van allele  parental expression difference mRNA 1:1 mix vs gDNA 1:1 mix  cis regulatory difference F1s vs gDNA 1:1 mix  trans regulatory difference F1s vs mRNA 1:1 mix  imprinting F1c vs F1v

10.  ~1.4M tiling probes at ~35bp resolution  ~1M SNP probes for 250K SNPs each SNP 2 alleles x 2 strands allele A antisense strand: GACCAATTTTGACCCTAGATCGCCA allele A sense strand : CTGGTTAAAACTGGGATCTAGCGGT allele B antisense strand: GACCAATTTTGAACCTAGATCGCCA allele B sense strand : CTGGTTAAAACTTGGATCTAGCGGT AtSNPtile: A SNP/tiling array

11. Allele intensity ratio as a measurement of allelic difference log (A / B) of probe intensity log (A / B) of template mixturetarget amount in ug Across strands and SNPs A: Col allele; B: Van allele

12. Linear regression for each SNP and strand The effect of overall target amount is small

13. SNPs within transcribed region

14. The model ContrastmRNA1:1 mixgDNA1:1 mixF1cF1v Model 1 1 (parental difference)100 2 11 3 (imprinting effect)001 Model 2 11/3 2 (cis variation)01/2 3001 Model 3 11/31/3 2 (trans variation)01/2 3001

15. cis only Here cis variation up-regulates Van allele

16. trans only Here trans variation up-regulates Col allele

17. FLC FLC – cis and trans cis variation up-regulates Col allele trans variation up-regulates Van allele Col Van reciprocal F1 hybrids

18. FRIGIDA FRIGIDA – No difference

19. Parental differencecis DeltaSig+Sig-TotalFALSEFDRSig+Sig-TotalFALSEFDR 0.158962128610248433042%509831968294357743% 0.25806610049070139415%3839227461135438.9% 0.35704669577412563.3%280016184418811.8% 0.4557995016300480.77%200211833185250.80% 0.5546443605004130.25%15008252325110.46% 0.653558253381140.11%1075590166550.30% 0.752606200280610.048%773453122630.20% 0.851657165182210.032%55834490210.15% 0.951077127120400.024%40826567310.094% transimprinting DeltaSig+Sig-TotalFALSEFDRSig+Sig-TotalFALSEFDR 0.15451001810063462746%110 289526317% 0.251281218133154219%4042957379% 0.356632663323024.8%3038282% 0.45544224427471.1%303137% 0.55329072910110.37%0000NA 0.6531685168820.15%0000NA 0.75372973210.080%0000NA 0.85324825100.085%0000NA 0.952919300.080%0000NA Summary for 12,311 analyzed genes An over-estimation of cis variation genes

20. The direction of cis and trans effects relative to that of parental expression difference

21. The size of cis and trans effects relative to that of parental expression difference cis vs parental difference trans vs parental difference trans vs cis

22. Validation for microarray result by single base extension coupled with Mass-spectrometry (ρ = 0.74, p < 1.08E -06, n=32)

23. Regional difference in sequence polymorphism between cis and trans genes

24. (Wittkopp 2004) Regulatory genes Structural genes Gene regulatory network

25. Chromosomal distributions of cis and trans genes Sliding window of 120 genes

26. model chr1 (df=3105)chr2 (df=1500)chr3 (df=2418)chr4 (df=1831)chr5 (df=2852) overall (df=11714) ρp-valueρ ρ ρ ρ ρ cis~trans-0.0718.04E-05-0.502.20E-16-0.562.20E-160.222.20E-16-0.402.20E-16-0.282.20E-16 cis~distance0.342.20E-160.482.20E-160.522.20E-160.202.20E-160.442.20E-160.392.20E-16 trans~distance-0.562.20E-16-0.177.11E-11-0.602.20E-16-0.142.47E-09-0.412.20E-16-0.412.20E-16 cis~polymorphism0.342.20E-160.652.20E-160.622.20E-160.282.20E-160.512.20E-160.482.20E-16 trans~polymorphism-0.482.20E-16-0.292.20E-16-0.722.20E-16-0.282.20E-16-0.462.20E-16-0.452.20E-16 polymorphism~distance0.582.20E-160.832.20E-160.802.20E-160.622.20E-160.622.20E-160.692.20E-16 Correlation of chromosomal distributions among cis, trans, sequence polymorphism and gene distance Sliding window of 120 genes

27. CG methylation for cis or trans genes CG methylation within promoter: repression gene expression CG methylation within gene proper: facilitate gene expression

28. Histone modification for cis and trans genes H3K27me3: Histone 3 lysine 27 trimethylation H3K9me3: Histone 3 lysine 9 trimethylation LND: low nucleosome density regions

29. Gene expression specificity for cis and trans genes Data from Schmid et al, 2005 63 diverse tissues on Col wild type background expression levelexpression entropy gene length

30. Conclusions  Large cis effect but more trans effect  cis genes tend to locate in polymorphic, gene-poor chromosomal regions, where repressive epigenetic modifications are enriched and gene expression is tightly regulated  trans genes tend to locate in conserved, gene-rich chromosomal regions, where activating epigenetic modifications are dominant and gene expression is more constitutive

31. Allele specific intron expression  Intron retention is common in plant  Allele specific intron expression suggests differential intron splicing

32. Summary for 6,707 analyzed introns Parental differencecis DeltaSig+Sig-TotalFALSEFDRSig+Sig-TotalFALSEFDR 0.15323814464684125127%299719334930159232% 0.252430101434441504.4%2327144837751925.1% 0.3518067312537210.83%178311012884421.5% 0.451283504178750.27%13677772144150.69% 0.55803399120210.12%995589158460.39% 0.6550228979110.065%675449112430.25% 0.7534120554600.039%48833582310.16% 0.8521215937100.032%33526560010.11% 0.9513911825700.023%23121144200.070% transimprinting DeltaSig+Sig-TotalFALSEFDRSig+Sig-TotalFALSEFDR 0.15146907041422202%20991191094919% 0.2541511555938%1331643267% 0.3514142717%0003NA 0.45077227%0001NA 0.550001NA0000 0.650000NA0000 0.750000NA0000 0.850000NA0000 0.950000NA0000

33. Distribution of sequence polymorphisms along up- and down-stream exons and the cis intron upstream exon downstream exon intron

34. Conclusions  extensive intron splicing variation  largely contribute by cis variation, no trans effect detected

35. Borevitz Lab: Justin Borevitz Yan Li Christos Noutsos Geoffrey Morris Andrew Cal Paul Grabowski Traci Viinanen Whitney Panneton Acknowledgements Greenhouse: Judy Coswell Sandra Suwanski John Zdenek