1. Comparative Genome Analysis

2. Comparative yeast genomics Kellis et al (2003) Nature 423, 241 - 254

3. Genic tree Inter-Genic tree

4. Reading Frame Conservation Species 1 ATG GAC GAT AGT CTT CGA GCA AAA TAG Species 2 TTG GAC GGA TAG TCT TGA GCA AAA AAG Species 3 CTG GA- GAT AGT CTT CGA GCA AAA TAG Species 4 --- --- GAT AGT -TT CGA GCA AAA TTA 6000 ORFs -> 5500 ORFs ORF no ORF }

5. Phylogenetic footprints

6. 72 motifs found: 40 known, 32 new

7. Ancient genome duplication Kellis, Birren & Lander (2004) Nature 428, 617 - 624

10. Duplicated protein evolution Average evolution (n = 457) Accelerated evolution (1 out of 72) Gene conversion Dating the WGD

11. Transcriptional regulatory code Harbison et al. (2004) Nature 431, 99 - 104

13. On-off Graded response Combinatorial regulation Physical interaction between regulators

14. Requires other molecule (leucine precursor) Requires regulation by movement Concentration dependent affinity changes Interaction with other regulator changes affinity

15. Mapping: principles

16. Variation Phenotypic traits Molecular markers –Microsattelites –Indels –SNPs Markers are polymorphic and determine only one genomic region

17. Linkage

20. Marker development: A Comparative Approach

21. Legume - Genomics Aim: Development of Molecular Markers for legume genetics Approach: CATS - Comparative anchor tagged sequences Alignment of ESTs from multiple legume species Alignment of EST to genomic region Intron

22. CATS – comparative anchor tagged sequences Alignment of ESTs from multiple legume species Alignment of EST to genomic region Intron Identification of evolutionary conserved regions Design of primers for PCR amplification of intron in mapping parents for polymorphism acertainment

23. Copyright ©2004 by the National Academy of Sciences Choi, Hong-Kyu et al. (2004) Proc. Natl. Acad. Sci. USA 101, 15289-15294, Doyle & Luckow 2003 18.000 species Legume Taxonomy Genome

24. Looking for conserved regions exon intron exon intron Lotus genome Glycine EST Medicago EST Phaseolus? AGC..ATCGATCAGGACAGT..TGTAC..CCCAC..AT GGAGGAGGACAATAAGAGAC CTAAACTCTCTCTAG TAC..CCCAC..AT AGC..AT GGG..AATAC..CCCAC..AT TAC..CC CAC..AT

25. Alignment: Lotus, Glycine, Medicago introns Good marker region

26. Reasons for conservation 1.Purifying selection on proteins conserves positions 1 and 2 of a codon 2.Selection on RNA G/C content introduces Codon bias that conserves the third position High G/C: constitutively expressed genes Low G/C: regulated genes (defense etc) 3.Purifying selection on RNA secondary structure Regulatory RNA molecules

27. CATS marker development

28. ETs: Expressed transcripts (full length cDNAs) TC: Tentative clusters

29. Three-way conservation Lotus Medicago Glycine 6261 8652 10655 11000 190000 330000 4463

30. Copyright ©2004 by the National Academy of Sciences Paterson, A. H. et al. (2004) Proc. Natl. Acad. Sci. USA 101, 9903-9908 Phylogenetic tree of whole genome duplications

31. Number of homologes in Arabidopsis Number of three way conserved sequences Three way conserved sequences vs. Arabidopsis homologe count

32. Macrosynteny Copyright ©2004 by the National Academy of Sciences Choi, Hong-Kyu et al. (2004) Proc. Natl. Acad. Sci. USA 101, 15289-15294

33. Macrosynteny between M. truncatula and L. japonicus Copyright ©2004 by the National Academy of Sciences Choi, Hong-Kyu et al. (2004) Proc. Natl. Acad. Sci. USA 101, 15289-15294 Phaseolus ? Leg148 Leg101 Leg178 Leg148

34. Microsynteny between Arabidopsis, M. truncatula and L. japonicus Copyright ©2004 by the National Academy of Sciences Choi, Hong-Kyu et al. (2004) Proc. Natl. Acad. Sci. USA 101, 15289-15294

35. Consensus comparative map data for six legume species Copyright ©2004 by the National Academy of Sciences Choi, Hong-Kyu et al. (2004) Proc. Natl. Acad. Sci. USA 101, 15289-15294