2. טרנסקריפציה השלב הראשון בתהליך התבטאות הגנים = סינתזת מולקולת RNA

4. What is a (protein-coding) gene? Protein mRNA DNA transcription translation CCTGAGCCAACTATTGATGAA PEPTIDEPEPTIDE CCUGAGCCAACUAUUGAUGAA

5. The pathway of gene expression Protein mRNA DNA transcription translation CCTGAGCCAACTATTGATGAA PEPTIDEPEPTIDE CCUGAGCCAACUAUUGAUGAA

6. Some nomenclature conventions RNAP

8. RNADNA

11. RNA Similarities and Differences Between DNA and RNA Similar strand structure Can define a 5’ and 3’ end 2’ hydroxyl in RNA: causes stability differences) Uracil in RNA takes the place of Thymine in in DNA

14. CCA adding enzyme RNase P מולקולת ה-RNA עוברת מבנה שניוני.

15. tRNA

16. מבנה שניוני של RNA Stem & loop

17. ההבדלים בין RNA ל DNA קבוצת OH בעמדה 2 של הריבוז (RNA) לעומת קבוצת H באותה עמדה ב- DNA. קבוצת ה-OH משפיעה על יציבות הקשר הפוספודיאסטרי (קשר הפוספאט). U מחליף T. בסיסים שעוברים מודיפיקציה גדיל ה-RNA יוצר מבנה שיניוני בניגוד ל DNA היוצר מבנה דו-גדילי בין שתי גדילי DNA - המבנה השיניוני של מולקולת ה RNA קובע את פעילות ה RNA.

21. Promoters Transcription starts at promoters on the DNA template RNA polymerase binds tightly to such promoters Sequence of this DNA is represented by the sense strand and has the same sequence and directionality as the transcribed RNA Two common sequences are present upstream (on the 5 ’ side) of the start site Rates at which E. coli genes are transcribed depend upon the stability of the initiation complex between the promotor and RNA polymerase

22. RNA polymerase

23. PromotersPromoters - DNA sequences that guide RNAP to the beginning of a gene (transcription initiation site). - DNA sequences that guide RNAP to the beginning of a gene (transcription initiation site). TerminatorsTerminators - DNA sequences that specify then termination of RNA synthesis and release of RNAP from the DNA. - DNA sequences that specify then termination of RNA synthesis and release of RNAP from the DNA. RNA Polymerase (RNAP)RNA Polymerase (RNAP) - Enzyme for synthesis of RNA. - Enzyme for synthesis of RNA. Reaction (ordered series of steps)Reaction (ordered series of steps) 1) Initiation. 1) Initiation. 2) Elongation. 2) Elongation. 3) Termination. 3) Termination. Bacterial (Prokaryotic) Transcription רצף המכוון את רנא פולימראז תחילת הגן רצף הגורם לרנא פולימראז להפסיק את תרגום הגן

24. Other important nomenclature conventions 5’ 3’ Template strand +1 Transcription Initiation Site Direction of transcription “Downstream”“Upstream” +2+2 +3+3 +4+4 +5+5 +6+6 -3-3 -1 -2-2 -4-4 -5-5 There is no “zero”

25. -10 region RNAP binds a region of DNA from -40 to +20 The sequence of the non-template strand is shown TTGACA…16-19 bp... TATAAT “-35” spacer “-10” Promoter sequences לאורך ה"ספיסר" יש משמעות – ארוך או קצר יוצר פרומוטר חלש

26. E. coli promoter sequences for 13 genes Promoter sequences for mRNAs. RNA polymerase seeks out the consensus sequences for proper orientation for binding to initiate transcription. Note promoter sites have regions of similar sequences at the -35 region and -10 region. Minus numbers represent bases upstream of mRNA start point, +1 is the first base in the RNA transcript. TR5

31. RNA polymerase II

33. Structure of E. coli RNA Polymerase Five core subunits  2  ’ω Sixth subunit (  ) binds core transiently and directs enzyme to specific DNA binding sites Has overall “hand” shape –Similar in structure to DNA polymerase –During chain elongation, thumb closes over DNA- binding channel

34. שלבי הטרנסקריפציה Initiation Elongation Termination

37. פקטור סיגמא

38. Sigma factor

39. Finding and binding the promoter Closed complex formation RNAP bound -40 to +20 Open complex formation RNAP unwinds from - 10 to +2 Binding of 1st NTP Requires high purine [NTP] Addition of next NTPs Requires lower purine [NTPs] Dissociation of sigma After RNA chain is 6-10 NTPs long initiation

40.   (sigma subunit) allows RNA polymerase to recognize and bind specifically to promoter regions. E. coli RNA polymerase +  subunit TR6

41. initiation

42. elongation

43. Chain Elongation RNA synthesis proceeds 5 ’ 3 ’ Double-stranded DNA is open at the point of RNA synthesis Transcription “ bubble ” moves with RNA polymerase DNA becomes more tightly wound (positively supercoiled) ahead of the transcription bubble and unwound (negatively supercoiled) behind the bubble

44. Sense and Antisense DNA Initiation of RNA synthesis occurs at specific sites on DNA DNA strand that serves as the template during transcription is the antisense (noncoding) strand Sense (coding) strand of DNA has the same sequence as the transcribed RNA, except for replacement of U with T

45. RNA polymerase elongation ה"עין" כ-12 זיווגי בסיסים

46. Elongation

47. mRNA Transcription TR7 רנא פולימראז מכניס שגיאה אחת ל-10000 נוקלאוטידים, אין לו מערכת לתיקון שגיאות טופואיזומראז לפני ואחרי רנא פולימראז

48. The theory of the template 2 - better Base pairing explained DNA replication. But no obvious structural complementarity between bases of DNA and amino acids of proteins

49. Subsequent hydrolysis of PPi drives the reaction forward RNA strand OH DNA strand RNA Synthesis is in the 5 ’ to 3 ’ Direction RNA has polarity (5’ phosphate, 3’ hydroxyl)

50. NTPs

51. Rho-Dependent Transcription Termination (depends on a protein AND a DNA sequence) G/C -rich site RNAP slows down Rho helicase catches up Elongating complex is disrupted

52. Rho-Independent Transcription Termination (depends on DNA sequence - NOT a protein factor) Stem-loop structure

53. Rho-independent transcription termination RNAP pauses when it reaches a termination site. The pause may give the hairpin structure time to fold The fold disrupts important interactions between the RNAP and its RNA product The U-rich RNA can dissociate from the template The complex is now disrupted and elongation is terminated

54. Rho-Independent Termination of Prokaryotic Transcription RNA transcript has self-complementary sequences permitting the formation of a hairpin structure Short string of adenylate residues in the template are transcribed into uridylates at the 3 ’ end Formation of hairpin disrupts interactions between RNA and RNA polymerase

55. Rho-Dependent Termination Rho factor (  ) is an ATP-dependent helicase that catalyzes the unwinding of RNA:DNA hybrid duplexes Recognizes C-rich regions in single-stranded RNA Advances in the 5 ’ 3 ’ direction until it reaches the transcription bubble with a paused RNA polymerase Unwinds the RNA-DNA duplex, releasing the RNA transcript Rho factor From Garrett & Grisham, Biochemistry (2 nd edition) Saunders, Fort Worth (1999)

56. termination סיום טרנסקריפציה

57. RNA polymerase

59. termination

61. Xmas tree – transcription

62. Xmas tree – transcription

64. Genes and Operons Genes are DNA sequences that encode polypeptides, rRNA, and tRNA, as well as sequences that have a role in initiating and ending transcription Most eukaryotic protein-coding genes are individually transcribed Many prokaryotic genes exist as operons and are transcribed together

65. Prokaryotic genes פוליציסטרוני – יחודי לפרוקריוטיים בלבד. באוקריוטים mRNA אחד יוצר סוג אחד של חלבון

66. Prokaryotic termination

74. מדוע צריך לבקר את אופן התבטאות הגנים בחיידקים? הסביבה בה החיידק נמצא משתנה. היכולת של החיידק לשרוד בסביבה המשתנה מותנת ביכולתו להתאים את עצמו. על החיידק לבטא את הגנים שלו על מנת לשרוד. אבל להפעלת הגנים ליצור מולקולות רנא וחלבונים יש מחיר אנרגטי יקר. לכן צריך להפעיל את הגנים כאשר זקוקים לתוצרים שלהם. חלבונים (והגנים שלהם) המבוטאים כל הזמן נקראים "housekeeping", בעוד שחלבונים המבוטאים כתלות בסביבה נקראים "inducible".

75. Alternate sigma factor usage: controls selective transcription of entire sets of genes s 32 s 60 vegetative (principal s) heat shock nitrogen starvation s 70 TTGACATATAAT (16-19 bp) (5-9 bp) A +1 CNCTTGACCCATNT (13-15 bp) (5-9 bp) A +1 CTGGNA TTGCA (6 bp) (5-9 bp) A +1 Ways to Regulate Transcription

76. Lac operon Lac II אופרון – קבוצת גנים המקודדים לחלבונים מאותו מעגל מטבולי ומאורגנים בקבוצה המבוטאת יחד.

77. טרנסקריפציה

80. The pathway of gene expression

81. Pre-mRNA

83. 5’UTR 3’UTR

84. בתאי כבד בעכבר

86. Eukaryotic Promoters More complex and diverse than prokaryotic promoters RNA polymerase I promoters –Multiple copies of rRNA genes exist –RNA polymerase I recognizes only one species-specific promoter –Requires a core promoter element and an upstream promoter element RNA polymerase III promoters have variable locations relative to the transcribed gene More attention has been paid to RNA polymerase II promoters because they are involved in the transcription of mRNA

87. יעילות ותדירות מיקום +1 רמה נמוכה (בזלית) E S RE אינטרונים