3. Fig. 4.19 Fig. 4.20a Molecular Mapping Markers

4. Fig. 4.20b

5. p. 143. Fluorescent dyes are often used to label DNA so that the positions of DAN fragments in a gel can be identified.

6. Genetics… …in the News

7. Chromosomal Mutations Chromosome mutations are variations from the wild-type condition in... –chromosome number, –chromosome structure,

8. Karyotypes (viewing chromosomes) …the chromosome complement of a cell or individual,.. refers to the arrangement of metaphase chromosomes according to length,

9. Human Karyotypes FemaleMale

10. Physical Maps (Cytological Maps) AT versus GC rich regions stain differently, –i.e. Giesma stain, –in a very reproducible fashion. Short arm “petit” (p), long arm (q), #s refer to regions, with differential staining. 1 2 3 p q

13. Chromosomal Mutations –chromosome number, –structure,

14. Aneuploidy...the gain or loss of a single chromosome, –monosomy: the loss of a single chromosome, –trisomy: the gain of a single chromosome.

15. Meiotic Nondisjunction...variation in chromosome number is caused by the failure of paired homologs to segregate properly during meiosis.

16. 2n = 2 first division second division(gametes) haploid gamete Disomic Normal Disjunction

17. 2n = 2 first division second division(gametes) haploid gamete Nondisjunction First Division Trisomic Monosomic

18. 2n = 2 first division second division(gametes) haploid gamete Nondisjunction Second Division Disomic TrisomicMonosomic

19. 46 Monosomy, 2n - 1 45, -5 2n = The loss of a single chromosome in an otherwise diploid cell.

20. Autosomal Monosomy nearly always deleterious, usually lethal, –recessive lethal alleles are expressed, C D B a E c d B A E diploid monosomic Aa BB Cc Dd EE recessive lethal allele C C c c CCCc cc recessive lethal alleles

21. Trisomy, 2n + 1 The gain of a single chromosome in an otherwise diploid cell. 46 2n = 47,+3

22. Autosomal Trisomy generally deleterious, –usually changes the phenotype of the individual, C D B A E c d B a E trisomic c d B a E

23. Jimsonweed (Datura stramonium) Trisomy in plants

24. Tomato

25. Down Syndrome (47, +21) Trisomy in Humans

26. Down Syndrome (47, +21) occurs at a frequency of about 0.15%, mental retardation (I.Q. 20 - 50), mean life expectancy is about 17 years, 47, +21 females are fertile, trisomy 21 risk factors, maternal age.

27. Down Syndrome Trisomy in Humans

28. Down Syndrome Critical Genes Chromosome 21 has about + 351 genes, –natural feedback mechanisms limit dosage effects of most of these genes, It is estimated that the improper expression of approximately 20-40 genes produces the variety of phenotypes.

29. Maternal Age and Down Syndrome

30. Maternal Age? in female humans, oocytes arrest in Prophase I before birth, –meiosis continues upon menstruation, –thus, tetrad formation and cellular function must be maintained for decades. and, as mother’s age increases, maternal detection of trisomy may be attenuated and spontaneous abortions drops.

31. Other Human Autosomal Trisomics Edwards Syndrome (47, +18) –0.0125% live births, –mental abnormalities, –“faunlike ears”, “rockerbottom feet”, small jaw, –nearly all die within several weeks of birth, Patau Syndrome (47, +13), – 0.005% live births, –mental abnormalities, –cleft lip, small mal-formed head, “rockerbottom feet”, –mean life expectancy is about 130 days.

32. Autosomal Trisomy Causation Age of Parents, Random Errors, –or genetic predisposition, Especially malfunction of recombination machinery, –crossing over and subsequent recombination are necessary for proper chromosome disjunction.

33. Sex Chromosome Monosomy Turner Syndrome (45, X), –sometimes referred to as XO,

34. Turner Syndrome (45,X) - 0.03% live female births, - infertile, - normal intelligence, although specific cognitive functions may be affected.

35. Sex Chromosome Trisomy Klinefelter Syndrome (47, XXY),

36. Klinefelter Syndrome (47, XXY) - 0.1% - 0.2% live male births, - infertile, - mildly retarded. 48, XXXY; 48, XXYY; 49, XXXXY; 49, XXXYY

37. XXX Syndrome (47, XXX) 47, XXX Syndrome, –0.08 % female births, –typically normal development, –fertile.

38. XYY Syndrome (47, XYY) 47, XYY Syndrome, –0.10 % male births, –above average height, –sub-normal intelligence, –fertile. Genetic Disposition for Antisocial and Criminal Behavior?No.

39. 1,000,000 Conceptions 5165 Chromosomal Abnormalities Sex Chromosome Aneuploid 1849 (about 2:1 males) Autosomal Trisomics 1183 (20: 2: 1) 850,000 Live Births 150,000 Spontaneous Abortions

40. 1,000,000 Conceptions 850,000 Live Births 150,000 Spontaneous Abortions 75,000 Chromosome Mutations 39,000; Trisomics 13,500; XO

41. Aneuploidy Summary Autosomal Monosomy, –nearly always deleterious, Autosomal Trisomy, –usually deleterious, –trisomic individuals usually show distinct phenotypes, Sex Chromosome Aneuploidy, –results in Turner or Klinefelter Syndromes, –47, XXX, often normal, – 47, XYY, mild retardation, tall.

43. Chapter 5 Do all of the practice questions (except 20).

44. Chromosomal Mutations Chromosome mutations are variations from the wild-type condition in... –chromosome number, –chromosome structure,

45. Polyploidy …more than two haploid sets of chromosomes are present, –2n = diploid, –3n = triploid, –4n = tetraploid, –etc.

46. Polyploidy Generalities de novo rare in most animal species, known in lizards, fish and amphibians, fairly common in plants, odd numbers of ploidy are not usually maintained, –3n, 5n, etc. rarely found in organisms that rely on sexual propagation.

47. Autopolyploidy... polyploidy resulting from the replication of one or more sets of chromosomes, …the additional set of chromosomes is identical to the normal haploid complement of that species.

48. added 1x 2x

49. Autopolyploidy …can be induced by treating cells with the drug colchicine, â colchicine: is a alkaloid derivative from the autumn crocus (Crocus veneris),...inhibits microtubule polymerization, and thus inhibits the separation of chromosomes during meiosis. Crocus veneris …autumn crocus, …meadow saffron, …naked ladies.

50. Colchicine Treatment 2n cells undergo S-phase, no separation of chromosomes is accomplished, no cell division occurs, at telophase, the nuclear membrane reforms, treatment for one cell cycle leads to 4n cells.

51. Natural Autopolyploidy Heat, cold also affect microtubule polymerization and can lead to autopolyploidy.

52. Allopolyploidy …formed by the union of two or more distinct chromosome sets,...i.e., from different species.

54. The Sad Tail of Raphanobrassica …Vegetable of the Proletariet? Cast Dr. G. Karpechenko, Russian Plant breeder, Brassica oleracea (2n = 18), - cabbage, large above ground food stock, ~value-less root, Raphanus sativus (2n = 18), - the common radish, large root food stock, ~value-less leaves.

55. Super Vegetable? Cabbage Radish 2n 1 = 18 2n 2 = 18 n 1 = 9 n 2 = 9 n 1 + n 2 = 18 sterile spontaneous autopolyploidy 2n 1 + 2n 2 = 36 x

56. Amphidiploid …double diploid, 2n 1 + 2n 2 …have balanced gametes of the type n 1 + n 2, these gametes fuse to make fertile 2n 1 + 2n 2.

57. Raphanobrassica? Roots of cabbage, leaves of radish, –dud-vegetable for Karpechenko, abandoned the project. Revived by the Scottish Plant Breeding Station in Dundee, Scotland, –Raphanobrassica’s high dry matter content makes it an excellent fodder for sheep and cattle.

58. Allopolyploidy in Plants Wheat Cotton Apples Plums Strawberries Longanberries Tobacco Potatoes more...

59. Autopolyploidy Applications Treating a parent plant with colchicine often produces autopolyploidy, resulting in offsprings with larger flowers and/or fruit, 8n8n2n2n 4n4n2n2n

60. Allopolyploidy Applications B. oleracea (cabbage, cauliflower, Brocolli, kale, etc.) 2n = 18 B. campestris (turnip, turnip rape) 2n = 20 n = 9 n = 10 amphidiploid n 1 + n 2 = 19B. napas ( Oil rape, canola oil) 2n 1 + 2n 2 = 38

61. 4n x 2n = 3n? The creation of triploids can be accomplished by crossing a tetraploid with a diploid, Most triploid individuals are sterile.

62. Generation of a Triploid Cells

63. Meiosis in a Triploid Organism

64. Who’d want to Eat That? Bananas, Seedless Watermelon, Most other seedless varieties, Some oysters.

65. Environmental Applications? grass carp (Ctenopharyngodon idella) grass carp prefer pondweeds, do not prefer plants such as cattail, water lily, etc.  Triploid grass carp do not reproduce…

66. Polyploidy Summary More than 2 whole sets of chromosomes, Autopolyploidy, –from the same genome, –naturally occurring, or induced, –often results in larger varieties, Allopolyploidy, –from different genomes, –naturally occurring, or induced, –often results in larger varieties, Autotriploids, –most often sterile –can produce beneficial traits.

67. Monoploidy …a haploid of a diploid is monoploid, …has one chromosome set.

68. Monoploid male wasps, bees and ants have only 1 haploid genome, –males develop from unfertilized eggs, gametes are formed by mitosis. Bees (example)

69. Monoploid Applications monoploid plants can be created by culturing pollen grains (n = 1), –the population of haploid organisms is then screened for favorable traits, –the plants are then treated with colchicine which generates a 2n plant homozygous for the favorable trait(s).

70. Chromosomal Mutations –chromosome number, –structure,

71. Chromosome Structure Changes in chromosome structure can come about due to, deletions duplications rearrangements

72. Chromosomal Deletions …a deletion results in a lost portion of a chromosome, –deletion causative agents, heat, radiation, viruses, chemicals, errors in recombination.

73. Terminal Deletions Off the End

74. Intercalary Deletions From the Middle

75. Recognizing Deletions Intercalary Terminal

76. Homologous Pairs? Intercalary Terminal Hemizygous Hemizygous: gene is present in a single dose. Psuedodominance: hemizygous genes are expressed.

77. Deletions …result in partial monosomy,  remember monosomy: 2n, -1, …the organism is monosomic for the portion of the chromosome that is deleted, …as in monosomy, most segmental deletions are deleterious.

78. Cri-du-chat Syndrome (46, -5p)

79. 46, -5p...terminal deletion of the small arm (petite arm) of chromosome 5, Cri-du-chat Syndrome, –0.002% live births, –anatomic mutations, –often mental retardation, –abnormal formation of vocal mechanisms.

80. Chromosome Structure Changes in chromosome structure can come about due to, deletions duplications rearrangements

81. Chromosomal Duplication...an event that results in the increase in the number of copies of a particular chromosomal region,

82. Duplication Cause and Effect Causes: –duplications often result from unequal crossing over, –can occur via errors in replication during S-Phase. Effects: –results in gene redundancy, –produces phenotypic variation, –may provide an important source for genetic variability during evolution.

83. Unequal Crossing Over Produces both duplications and deletions!

84. Duplication Phenotypes

85. Duplication in Evolution …essential genes do not tolerate mutation, …duplications of essential genes, followed by mutations, confers adaptive potential to the organism, …new gene family members are ‘recruited’ to perform new functions.

86. nutrients algae need uptake transport to other tissue transport to seeds moss need uptake flowering plant transport to other tissue need uptake

87. Arabidopsis

88. Chromosome Structure Changes in chromosome structure can come about due to, deletions duplications rearrangements

89. Chromosomal Inversions …inversion: aberration in which a portion of the chromosome is turned around 180 o.

90. Paracentric Inversion...an inversion in which the centomere is not included, ABC...a paracentric inversion does not change arm length ratio. BACBA

91. Inversion Heterozygotes …an organism with one wild-type and one chromosome containing an inversion, ABC …not heterozygous for the genes, heterozygous for the chromosomes. ABC

92. Inversion Loop no crossing over gametes

93. Produces haploid gamete. Paracentric

94. Produces gamete with inversion. Paracentric

95. Produces a chromosome with two centromeres. Nonviable gametes. Paracentric

96. Dicentric...a chromosome having two centromeres;

97. Non-Viable (gametes) Segregate

98. Dicentric/Ascentric …results only when the crossing over occurs within the region of the paracentric inversion,

99. No centromeres. Deletions. Nonviable gametes. Paracentric

100. Acentric …a chromosome having no centromeres, …segregates to daughter cells randomly, or is lost during cell division, …deletions impart partial monosomy.

101. Paracentric Outcomes 1 Normal Gamete, 1 Inversion Gamete, No Crossover Classes Recombination is not inhibited, but recombinant gametes are selected against.

102. Plant Biotechnology Information later in the Quarter

103. Pericentric Inversion...an inversion in which the centromere is included, ABCABC...a pericentric inversion results in a change in chromosome arm length.

104. Pericentric

105. Recombination and Inversions Paracentric and Pericentric; –1 Normal Gamete, – 1 Inverted Gamete, – (No) Crossover Classes = No Recombination… …in area of inversion. Inversions select against recombinant gametes, thus preserves co-segregation of specific alleles.

106. Inversions and Evolution Inversions ‘lock’ specific alleles together, –all offspring get their alleles from either a wild- type, or inverted chromosome, If the ‘set of alleles’ is advantageous, the set can be maintained in the population.

107. Assignment Know how inversions alter the outcomes of recombination, Understand the differences between ‘Interference’, and the suppression of recombination resulting from inversions, Be able to recognize data, and predict results given either case.

108. Chapter 5 Do all of the practice questions (except 20).

109. Chromosome Structure Changes in chromosome structure can come about due to, deletions duplications rearrangements

110. Translocations …translocation: aberration associated with the transfer of a chromosomal segment to a new location in the genome.

111. Terminal Translocation

112. Reciprocal Translocation

113. Translocation and Semi-Sterility …semi-sterility; a condition in which a proportion of all gametophytes (in plants) or zygotes (in animals) are inviable. Up to 50% are inviable as a result of translocations.

115. Robertsonian Translocations …the fusion of long arms of acrocentric chromosomes,

116. Down Syndrome 95% of Down Syndrome individuals are a result of Trisomy 21, –the probability of having a second Down Syndrome child is usually similar to the population at large, However, there is second cause of Down Syndrome caused by a Robertsonian translocations that is heritable.

117. Familial Down Syndrome

118. Assignment Do a Punnett Square or a Split Fork Diagram of, Parent 1: wild-type for Chromosomes 14, 21 x Parent 2: heterozygous for 14q;21q translocation.

119. Hint gametes

120. Assignment (think about these...) Truncated Genes; –genes that are no longer full length, due to a mutation, Gene Fusions; –genes that contain coding sequence from two different genes, resulting from a chromosomal mutation.

121. Trinucleotide Repeat Expansions FMR1 Fragile X Mental Retardation 1 cgg...GCGCGGCGGTGACGGAGGCGCCGC TGCCAGGGGGCGTGCGGCAGCG... …CTGGGCCTCGAAGCGCCCGCAGCCA cgg... > 200

123. Fragile Site Mutations

125. Syntenic Relationship of two or more loci found to be linked in one species; literally “on the same thread”. Conserved Synteny: state in which the same two loci are found to be linked in several species.

126. Cereals

127. Conserved Synteny Description of DNA segments in which gene order is identical between species.

128. Chapter 5 Review know genotypes and phenotypes, –trisomy, –monosomy, –inversions, –duplications, –deletions, –polyploidy, –dosage compensation. be able to predict heritability, and recognize data- sets and infer the condition.

129. Wednesday Reciprocal Translocations, Mapping deletions, Review Work some problems.

130. Dosage Compensation X chromosomes in females provide twice the genes, as in males, –Drosophila: female genes are expressed at 50% of the male levels, –Mammals: one X chromosome in females is silenced.

131. Canadian Cat Scientist Sees it First Barr Body

132. Lyon Hypothesis Mary Lyon; in humans, X chromosomes from father and mother are randomly inactivated.

133. X Inactivation The structure of the chromosome is altered. Barr Body

134. X-Linked Mosaicism Different cell lineages contribute to different body locations on the body.