1. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Chapter 13 An Introduction to Cloning and Recombinant DNA

2. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Southern Blot Technique

3. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Southern Blot Technique Used to determine the structure of a gene or DNA sequence of interest May be used to analyze different alleles, related genes, and gene evolution

4. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Southern Blot Technique Steps –Isolate genomic DNA –Cut DNA with restriction enzymes –Separate DNA by size using electrophoresis –Transfer DNA to a membrane –Probe with sequence of interest that is radioactively labeled –Visualize with X-rays

5. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Fig. 13.19 The Southern Blot Technique

6. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Credit: © Inga Spence/Visuals Unlimited 212643 DNA Hybridization Blot on BioRad Gel Doc 1000 Imager.

7. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Sequencing

8. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning GTACACTTACGTACTCCTCAACGGATC DNA Sequencing

9. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning + primer CATGT GTACACTTACGTACTCCTCAACGGATC DNA Sequencing

10. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning GTACACTTACGTACTCCTCAACGGATC CATGT DNA Sequencing

11. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning GTACACTTACGTACTCCTCAACGGATC + DNA polymerase + A, C, T, G CATGT DNA Sequencing

12. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning GTACACTTACGTACTCCTCAACGGATC CATGT + DNA polymerase + A, C, T, G GTACACTTACGTACTCCTCAACGGATC CATGTGAATGCATGAGGAGTTGCGTAG DNA Sequencing

13. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning GTACACTTACGTACTCCTCAACGGATC CATGT + DNA polymerase + A, C, T, G + T DNA Sequencing

14. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA polynucleotide chain 5’ end O-O- O - -P = O O CH 2 Base O H 3 ’ H H H 5’ O-O- O - -P = O O CH 2 Base H 3 ’ H H H O 5’ OH 3’ end

15. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA polynucleotide chain 5’ end O-O- O - -P = O O CH 2 Base O H 3’3’ H 5’ 3’ end O-O- O - -P = O O CH 2 Base H 3’3’ H O 5’ H dideoxy base chain termination H H H H

16. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning GTACACTTACGTACTCCTCAACGGATC CATGT + DNA polymerase + A, C, T, G + T GTACACTTACGTACTCCTCAACGGATC CATGTG DNA Sequencing

17. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning GTACACTTACGTACTCCTCAACGGATC CATGT + DNA polymerase + A, C, T, G + T GTACACTTACGTACTCCTCAACGGATC CATGTGA DNA Sequencing

18. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning GTACACTTACGTACTCCTCAACGGATC CATGT + DNA polymerase + A, C, T, G + T GTACACTTACGTACTCCTCAACGGATC CATGTGAA DNA Sequencing

19. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning GTACACTTACGTACTCCTCAACGGATC CATGT + DNA polymerase + A, C, T, G + T GTACACTTACGTACTCCTCAACGGATC CATGTGAAT DNA Sequencing

20. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning GTACACTTACGTACTCCTCAACGGATC CATGT + DNA polymerase + A, C, T, G + T GTACACTTACGTACTCCTCAACGGATC CATGTGAAT DNA Sequencing

21. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning GTACACTTACGTACTCCTCAACGGATC CATGT + DNA polymerase + A, C, T, G + T GTACACTTACGTACTCCTCAACGGATC CATGTGAAT CATGTGAATGCAT DNA Sequencing

22. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning GTACACTTACGTACTCCTCAACGGATC CATGT + DNA polymerase + A, C, T, G + T GTACACTTACGTACTCCTCAACGGATC CATGTGAAT CATGTGAATGCAT DNA Sequencing

23. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning GTACACTTACGTACTCCTCAACGGATC CATGT + DNA polymerase + A, C, T, G + T GTACACTTACGTACTCCTCAACGGATC CATGTGAAT CATGTGAATGCAT CATGTGAATGCATGAGGAGT DNA Sequencing

24. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Sequencing

25. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning T DNA Sequencing

26. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning GTACACTTACGTACTCCTCAACGGATC CATGT + DNA polymerase + A, C, T, G + T GTACACTTACGTACTCCTCAACGGATC CATGTGAAT CATGTGAATGCAT CATGTGAATGCATGAGGAGT DNA Sequencing

27. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning GTACACTTACGTACTCCTCAACGGATC CATGT + DNA pol + A, C, T, G + T + DNA pol + A, C, T, G + A + DNA pol + A, C, T, G + G + DNA pol + A, C, T, G + C DNA Sequencing

28. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning TAGC DNA Sequencing

29. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning TAGC G DNA Sequencing

30. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning TAGC G A DNA Sequencing

31. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning TAGC G A A DNA Sequencing

32. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning TAGC G A A T DNA Sequencing

33. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning TAGC G A A T G C A T G A DNA Sequencing

34. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning GTACACTTACGTACTCCTCAACGGATC CATGTGAATGCATGAGGAGTTGCCTAG DNA Sequencing

35. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning TAGC G A A T G C A T G A C T T A C G T A C T DNA Sequencing

36. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Improvements in Sanger Sequencing Four-color fluorescent dyes Use of scanners to read laser-induced fluorescence as products run off Improvements in sequencing reaction enzymes Replacement of slab gel electrophoresis with capillary gel electrophoresis

37. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning GTACACTTACGTACTCCTCAACGGATC CATGT + DNA pol + A, C, T, G + T + DNA pol + A, C, T, G + A + DNA pol + A, C, T, G + G + DNA pol + A, C, T, G + C DNA Sequencing

38. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning GTACACTTACGTACTCCTCAACGGATC CATGT + DNA pol + A, C, T, G + T + DNA pol + A, C, T, G + A + DNA pol + A, C, T, G + G + DNA pol + A, C, T, G + C DNA Sequencing

39. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Sequencing GTACACTTACGTACTCCTCAACGGATC CATGT + DNA pol + A, C, T, G

40. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Automated DNA Sequencing Fig. 13.20

41. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Automated Sequencer

42. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Sequencing is just the start…

43. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Microarrays

44. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Goal: To get at complete expression profile in a cell/tissue at given time Step 1: Make or purchase microarray Need gene sequences and sequenced genomes PCR up real and predicted ORFs Spot on glass slide/chip DNA Microarrays

45. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning DNA Microarrays

46. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Isolate RNA from 2 different kinds of cells to be compared Cell 1 - RNA labeled with red fluorescent tag Cell 2 - RNA labeled with green fluorescent tag Step 2: Isolate and label RNA DNA Microarrays

47. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Step 3: Hybridize RNA to Microarray DNA Microarrays Hybridize chip with red and green RNA Use scanner to examine fluorescence Red - RNA present in Cell 1 but not Cell 2 Green - RNA present in Cell 2 but not in Cell 1 Yellow - RNA present in both

48. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Microarray Results

49. Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning Stem cells Saunders Magee Shriner-Cahn Chatterjee Lawrence Olson Prenatal genetic testing Brower Gorenkoff Kwak Cho Damiano Cheis Cloning of animals/humans Bondurant Lapides Simon Vigneron Prada Siegel Genetically modified plants/animals Powers Rosenblum Le Sotomil Coyle Kropp Too much technology? Spiwak Davidson Fei Grossman Marwell Roth Behavioral genes Seplowitz Rich Lenard Collins Dionne Rudberg