Presentation is loading. Please wait.

Presentation is loading. Please wait.

6.1 Short foreach revision. 6.2 $arr[2]$arr[1]$arr[3]$arr[4] Loops: foreach The foreach loop passes through all the elements of an array = (2,3,4,5,6);

Published by Modified over 9 years ago

Similar presentations

Presentation on theme: "6.1 Short foreach revision. 6.2 $arr[2]$arr[1]$arr[3]$arr[4] Loops: foreach The foreach loop passes through all the elements of an array = (2,3,4,5,6);"— Presentation transcript:

1 6.1 Short foreach revision

2 6.2 $arr[2]$arr[1]$arr[3]$arr[4] Loops: foreach The foreach loop passes through all the elements of an array my @arr = (2,3,4,5,6); my $mul = 1; @arr$num $arr[0] foreach my $num (@arr) { $mul = $mul *$num; } 234 5 6 undef 1 120246 $mul 2720

3 6.3 Some Eclipse Tips Try Ctrl+Shift+L Quick help (keyboard shortcuts) Try Ctrl+SPACE Auto-complete Source→Format ( Ctrl+Shift+F ) Correct indentation You can maximize a single view of Eclipse. Debug Debug & Debug!!! Break points... The (default) location of your files are: At home: D:\eclipse\perl_ex Computer class: C:\eclipse\perl_ex

4 6.4 Pattern matching

5 6.5 We often want to find a certain piece of information within the file, for example: Pattern matching 1.Exract GI numbers or accessions from Fasta 2.Extract the coordinates of all open reading frames from the annotation of a genome 3.Extract the accession, description and score of every hit in the output of BLAST All these examples are patterns in the text. We will see a wide range of the pattern-matching capabilities of Perl, but much more is available – We strongly recommend using documentation/tutorials/google. >gi|16127995|ref|NP_414542.1| thr operon … >gi|145698229|ref|YP_001165309.1| hypothetical … >gi|90111153|ref|NP_415149.4| citrate … >gi|16127995|ref|NP_414542.1| thr operon … >gi|145698229|ref|YP_001165309.1| hypothetical … >gi|90111153|ref|NP_415149.4| citrate … Score E Sequences producing significant alignments: (bits) Value ref|NT_039621.4|Mm15_39661_34 Mus musculus chromosome 15 genomic... 186 1e-45 ref|NT_039353.4|Mm6_39393_34 Mus musculus chromosome 6 genomic c... 38 0.71 ref|NT_039477.4|Mm9_39517_34 Mus musculus chromosome 9 genomic c... 36 2.8 CDS 1542..2033 CDS complement(3844..5180)

6 6.6 Finding a sub-string (match) somewhere in a string: if ($line =~ m/he/)... remember to use slash ( / ) and not back-slash Will be true for “ hello ” and for “ the cat ” but not for “ good bye ” or “ Hercules ”. You can ignore case of letters by adding an “ i ” after the pattern: m/he/i (matches for “ the ”, “ Hello ”, “ Hercules ” and “ hEHD ”) There is a negative form of the match operator: if ($line !~ m/he/)... Pattern matching

7 6.7 m/./ Matches any character (except “ \n ”) You can also ask for one of a group of characters: m/[atcg]/ Matches “a” or “t” or “c” or “g” m/[a-d]/ Matches “a” though “d” (a, b, c or d) m/[a-zA-Z]/ Matches any letter m/[a-zA-Z0-9]/ Matches any letter or digit m/[a-zA-Z0-9_]/ Matches any letter or digit or an underscore m/[^atcg]/ Matches any character except “a” or “t” or “c” or “g” m/[^0-9]/ Matches any character except a digit Single-character patterns

8 6.8 TATTAA TATAATA CTATATAATAGCTAGGCGCATG ✗ ✔ ✔ For example: if ($line =~ m/TATAA[AT]/) Will be true for? Single-character patterns TATTAA TATAATA CTATATAATAGCTAGGCGCATG

9 6.9 ? means zero or one repetitions: m/ab?c/ Matches “ ac ” or “ abc ” + means one or more repetitions: m/ab+c/ Matches “ abc ” ; “ abbbbc ” but not “ ac ” A pattern followed by * means zero or more repetitions of that patern: m/ab*c/ Matches “ abc ” ; “ ac ” ; “ abbbbc ” Generally – use { } for a certain number of repetitions, or a range: m/ab{3}c/ Matches “ abbbc ” m/ab{3,6}c/ Matches “ a ”, 3-6 times “ b ” and then “ c ” m/ab{3,}c/ Matches “ a ”, “ b ” 3 times or more and then “ c ” Use parentheses to mark more than one character for repetition: m/h(el)*lo/ Matches “ hello ” ; “ hlo ” ; “ helelello ” Repetitive patterns

10 6.10 TATAAAGAATG ACTATAATAAAAATG TATAATGATGTATAATATCG ✔ ✔ ✗ For example: if ($line =~ m/TATAA[AT][ATCG]{2,4}ATG/) Will be true for? Single-character patterns TATAAAGAATG ACTATAATAAAAATG

11 6.11 Perl provides predefined character classes: \d a digit (same as: [0-9] ) \w a “word” character (same as: [a-zA-Z0-9_] ) \s a space character (same as: [ \t\n\r\f] ) For example: if ($line =~ m/class\.ex\d\.\S/) Single-character patterns And their negatives: \D anything but a digit \W anything but a word char \S anything but a space char ✔ ✗ ✔ class.ex3.1.pl class.ex3. my class.ex8.(old) class.ex3.1.pl class.ex3. my class.ex8.(old)

12 6.12 Consider the following code: print "please enter a line...\n"; my $line = ; chomp($line); if ( $line =~ m/-?\d+/ ) { print "This line seems to contain a number...\n"; } else { print "This is certainly not a number...\n"; } Example code

13 6.13 Consider the following code: open(IN, "<numbers.txt") or die "cannot open numbers.txt"; my $line = ; while (defined $line) { if ( $line =~ m/-?\d+/ ) { print "This line seems to contain a number...\n"; } else { print "This is certainly not a number...\n"; } $line = ; } Example code

14 6.14 RegEx Coach An easy to use tool for testing regular expressions: http://weitz.de/files/regex-coach.exe http://weitz.de/files/regex-coach.exe

15 6.15 Class exercise 6a Write the following regular expressions. Test them with a script that reads a line from STDIN and prints "yes" if it matches and "no" if not. 1. Match a name containing a capital letter followed by three lower case letters 2. Match an NLS (nuclear localization signal) that start with K followed by K or R followed by any character followed by either K or R. 3. Match an NLS that start with K followed by K or R followed by any character except D or E, followed by either K or R. Match either small or capital letters 4*. Match 3 - 15 characters between quotes (without another quote inside the quotes).

16 6.16 Replacing a sub string (substitute): $line = "the cat on the tree"; $line =~ s/he/hat/; $line will be turned to “ that cat on the tree ” To Replace all occurrences of a sub string add a “ g ” (for “globally”): $line = "the cat on the tree"; $line =~ s/he/hat/g; $line will be turned to “ that cat on that tree ” Pattern matching

17 6.17 Perl provides predefined character classes: \d a digit (same as: [0-9] ) \w a “word” character (same as: [a-zA-Z0-9_] ) \s a space character (same as: [ \t\n\r\f] ) And a substitute example for $line = "class.ex3.1.pl"; $line =~ s/\W/-/; class-ex3.1.pl $line =~ s/\W/-/g; class-ex3-1-pl Single-character patterns And their negatives: \D anything but a digit \W anything but a word char \S anything but a space char

18 6.18 Class exercise 6b 1.Write the following regular expressions substitutions. For each string print it before the substitution and after it a)Replace every T to U in a DNA sequence. b)Replace every digit in the line with a #, and print the result. c)Replace any number and kind of white space (new-line, tab or space) by a single space. d*)Remove all such appearances of "is" from the line (both small and capital letters), and print it.

19 6.19 To force the pattern to be at the beginning of the string add a “ ^ ”: m/^>/ Matches only strings that begin with a “ > ” “ $ ” forces the end of string: m/\.pl$/ Matches only strings that end with a “.pl ” And together: m/^\s*$/ Matches empty lines and all lines that contains only space characters. Enforce line start/end

20 6.20 m/\d+(\.\d+)?/ Matches numbers that may contain a decimal point: “ 10 ”; “ 3.0 ”; “ 4.75 ” … m/^NM_\d+/ Matches Genbank RefSeq accessions like “ NM_079608 ” OK… now let's do something more complex… Some examples

21 6.21 Let's take a look at the adeno12.gb GenBank record….adeno12.gb Matches annotation of a coding sequence in a Genbank DNA/RNA record: CDS 87..1109 m/^\s*CDS\s+\d+\.\.\d+/ Allows also a CDS on the minus strand of the DNA: CDS complement(4815..5888) m/^\s*CDS\s+(complement\()?\d+\.\.\d+\)?/ Some GenBank examples Note: We could just use m/^\s*CDS/ - it is a question of the strictness of the format. Sometimes we want to make sure.

22 6.22 We can extract parts of the pattern by parentheses: $line = "1.35"; if ($line =~ m/(\d+)\.(\d+)/ ) { print "$1\n"; 1 print "$2\n"; 35 } Extracting part of a pattern

23 6.23 We can extract parts of the string that matched parts of the pattern that are marked by parentheses: my $line = " CDS 87..1109"; if ($line =~ m/CDS\s+(\d+)\.\.(\d+)/ ) { print "regexp:$1,$2\n";regexp:87,1109 my $start = $1; my $end = $2; } Extracting part of a pattern

24 6.24 Usually, we want to scan all lines of a file, and find lines with a specific pattern. E.g.: my ($start,$end); foreach $line (@lines) { if ($line =~ m/CDS\s+(\d+)\.\.(\d+)/ ) { $start = $1; $end = $2;...... } } Finding a pattern in an input file

25 6.25 We can extract parts of the string that matched parts of the pattern that are marked by parentheses. Suppose we want to match both $line = " CDS complement(4815..5888)"; and $line = " CDS 6087..8109"; if ($line =~ m/CDS\s+(complement\()?((\d+)\.\.(\d+))\)?/ ) { print "regexp:$1,$2,$3,$4.\n"; $start = $3; $end = $4; } Use of uninitialized value in concatenation... regexp:,6087..8109,6087,8109. Extracting part of a pattern

26 6.26 Write a script that extracts and prints the following features from a Genbank record of a genome (Use adeno12.gb)adeno12.gb 1.Print all the JOURNAL lines 2.Print all the JOURNAL lines, without the word JOURNAL, and until the first digit in the line (hint in white: match whatever is not a digit). 3.Find the JOURNAL lines and print only the page numbers 4.Find lines of protein_id in that file and extract the ids (add to your script from the previous question). 5.Find lines of coding sequence annotation (CDS) and extract the separate coordinates (get each number into a separate variable). Try to match all CDS lines… (This question is part of home ex. 4). Class exercise 6c

Download ppt "6.1 Short foreach revision. 6.2 $arr[2]$arr[1]$arr[3]$arr[4] Loops: foreach The foreach loop passes through all the elements of an array = (2,3,4,5,6);"

Similar presentations

Arrays A list is an ordered collection of scalars. An array is a variable that holds a list. Arrays have a minimum size of 0 and a very large maximum size.

Arrays A list is an ordered collection of scalars. An array is a variable that holds a list. Arrays have a minimum size of 0 and a very large maximum size.
CATHERINE AND ANNIE Python: Part 3. Intro to Loops Do you remember in Alice when you could use a loop to make a character perform an action multiple times?

CATHERINE AND ANNIE Python: Part 3. Intro to Loops Do you remember in Alice when you could use a loop to make a character perform an action multiple times?
Programming and Perl for Bioinformatics Part III.

Programming and Perl for Bioinformatics Part III.
6.1 Pattern Matching. 6.2 We often want to find a certain piece of information within the file: Pattern matching 1.Find all names that end with “man”

6.1 Pattern Matching. 6.2 We often want to find a certain piece of information within the file: Pattern matching 1.Find all names that end with “man”
Regular Expression (1) Learning Objectives: 1. To understand the concept of regular expression 2. To learn commonly used operations involving regular expression.

Regular Expression (1) Learning Objectives: 1. To understand the concept of regular expression 2. To learn commonly used operations involving regular expression.
CS 898N – Advanced World Wide Web Technologies Lecture 8: PERL Chin-Chih Chang

CS 898N – Advanced World Wide Web Technologies Lecture 8: PERL Chin-Chih Chang
CS311 – Today's class Perl – Practical Extraction Report Language. Assignment 2 discussion Lecture 071CS 311 - Operating Systems I.

CS311 – Today's class Perl – Practical Extraction Report Language. Assignment 2 discussion Lecture 071CS Operating Systems I.
4.1 Controls: Ifs and Loops. 4.2 Controls: if ? Controls allow non-sequential execution of commands, and responding to different conditions else { print.

4.1 Controls: Ifs and Loops. 4.2 Controls: if ? Controls allow non-sequential execution of commands, and responding to different conditions else { print.
6ex.1 Pattern Matching. 6ex.2 We often want to find a certain piece of information within the file: Pattern matching 1.Find all names that end with “man”

6ex.1 Pattern Matching. 6ex.2 We often want to find a certain piece of information within the file: Pattern matching 1.Find all names that end with “man”
COS 381 Day 19. Agenda  Assignment 5 Posted Due April 7  Exam 3 which was originally scheduled for Apr 4 is going to on April 13 XML & Perl (Chap 8-10)

COS 381 Day 19. Agenda  Assignment 5 Posted Due April 7  Exam 3 which was originally scheduled for Apr 4 is going to on April 13 XML & Perl (Chap 8-10)
4ex.1 More loops. 4ex.2 Loops Commands inside a loop are executed repeatedly (iteratively): my $num=0; print Guess a number.\n; while ($num != 31) {

4ex.1 More loops. 4ex.2 Loops Commands inside a loop are executed repeatedly (iteratively): my $num=0; print "Guess a number.\n"; while ($num != 31) {
Scripting Languages Chapter 6 I/O Basics. Input from STDIN We’ve been doing so with $line = chomp($line); Same as chomp($line= ); line input op gives.

Scripting Languages Chapter 6 I/O Basics. Input from STDIN We’ve been doing so with $line = chomp($line); Same as chomp($line= ); line input op gives.
Scalar Variables Start the file with: #! /usr/bin/perl –w No spaces or newlines before the the #! “#!” is sometimes called a “shebang”. It is a signal.

Scalar Variables Start the file with: #! /usr/bin/perl –w No spaces or newlines before the the #! “#!” is sometimes called a “shebang”. It is a signal.
7.1 Last time on: Pattern Matching. 7.2 Finding a sub string (match) somewhere: if ($line =~ m/he/)... remember to use slash( / ) and not back-slash Will.

7.1 Last time on: Pattern Matching. 7.2 Finding a sub string (match) somewhere: if ($line =~ m/he/)... remember to use slash( / ) and not back-slash Will.
11ex.1 Modules and BioPerl. 11ex.2 sub reverseComplement { my ($seq) $seq =~ tr/ACGT/TGCA/; $seq = reverse $seq; return $seq; } my $revSeq = reverseComplement(GCAGTG);

11ex.1 Modules and BioPerl. 11ex.2 sub reverseComplement { my ($seq) $seq =~ tr/ACGT/TGCA/; $seq = reverse $seq; return $seq; } my $revSeq = reverseComplement("GCAGTG");
Regular Expressions Regular Expression (or pattern) in Perl – is a template that either matches or doesn’t match a given string. if( $str =~ /hello/){

Regular Expressions Regular Expression (or pattern) in Perl – is a template that either matches or doesn’t match a given string. if( $str =~ /hello/){
7.1 Some Eclipse Tips Try Ctrl+Shift+L Quick help (keyboard shortcuts) Try Ctrl+SPACE Auto-complete Source→Format ( Ctrl+Shift+F ) Correct indentation.

7.1 Some Eclipse Tips Try Ctrl+Shift+L Quick help (keyboard shortcuts) Try Ctrl+SPACE Auto-complete Source→Format ( Ctrl+Shift+F ) Correct indentation.
13.1 Wrapping up. 13.2 Running Other Programs 13.3 You may run programs using the system function: $exitValue = system(blastall.exe...); if ($exitValue!=0)

13.1 Wrapping up Running Other Programs 13.3 You may run programs using the system function: $exitValue = system("blastall.exe..."); if ($exitValue!=0)
8.1 Last time on: Pattern Matching. 8.2 Finding a sub string (match) somewhere: if ($line =~ m/he/)... remember to use slash( / ) and not back-slash Will.

8.1 Last time on: Pattern Matching. 8.2 Finding a sub string (match) somewhere: if ($line =~ m/he/)... remember to use slash( / ) and not back-slash Will.
More Regular Expressions. List/Scalar Context for m// Last week, we said that m// returns ‘true’ or ‘false’ in scalar context. (really, 1 or 0). In list.

More Regular Expressions. List/Scalar Context for m// Last week, we said that m// returns ‘true’ or ‘false’ in scalar context. (really, 1 or 0). In list.

Similar presentations

Ads by Google