1. Genetic tools for metabolic enzyme production in Escherichia coli Jay D. Keasling Department of Chemical Engineering University of California Berkeley, CA 94720

2. Terpenoids Essential oils Menthol C-10 Monoterpene Carotenoids Lycopene C-40 Tetraterpene Chemotherapeutics Taxol C-20 diterpene Eleutherobin C-20 Diterpene > 50,000 known molecules

3. Terpenoid metabolic pathways

4. The DXP pathway Dimethylallyl Pyrophosphate (DMAPP) 4-diphosphocytidyl-2C-methyl- D-erythritol-2-phosphate IspD IspF IspE Pyruvate 1-deoxy-D- xylulose-5- phosphate (DXP) 2C-methyl-D- erythritol-4- phosphate (MEP) 4-diphospho-2C- methyl-D-erythritol 2C-methyl-D- erythritol 2,4-cyclodiphosphate Isopentenyl Pyrophosphate (IPP) D-glyceraldehyde- 3-phosphate (G3P) pyridoxine thiamine 1-hydroxy-2-methyl- 2-(E)-butenyl 4- diphosphate IspG IspH Dxr Dxs

5. The mevalonate pathway

6. Artemisinin Artemisia annua O O O O O

7. Artemisinin-based drugs The current cost for an artemisinin- based drug is approximately $2.25. –Artemisinin generally adds $1.00- 1.50 to the cost for drugs –Most developing countries spend less than $4/person/year on health care As many as 10-12 treatments are needed for each person annually World Health Organization estimates that 700 tons will be needed annually O O O O O

8. Microbial production of artemisinin Advantages –Microbial fermentations are relatively simple to scale up –Inexpensive starting materials can be used Challenges –Need the genes for all of the enzymes in the pathway –Not always simple to express in microbes the genes from very different organisms –Need to balance metabolic pathways to optimize production –Need a good “platform organism” with appropriate gene expression tools

9. Synthesis of artemisinin in E. coli Identify the enzymes

10. Synthesis of artemisinin in E. coli Clone the genes

11. Synthesis of artemisinin in E. coli Well characterized parts to control gene expression

12. Synthesis of artemisinin in E. coli Supply of intracellular precursors

13. Gene expression tools for metabolic engineering Plasmid

14. Plasmid copy number can influence gene expression levels High-copy plasmid Low-copy plasmid C A B XY1Z Enzyme 1Enzyme 3 Enzyme 2 Enzyme 4 Y2 C A B XY1Z Enzyme 1Enzyme 3 Enzyme 2 Enzyme 4 Y2

15. dxs expressed from a high-copy plasmid P const crtEcrtIcrtY P tac dxs Pyr + G3P IPP FPP DXS DMAPP Carotenoids CrtE CrtI CrtY High-copy plasmid

16. Carotenoid production in cells expressing dxs from a high-copy plasmid 0 1 2 3 4 5 6 7 0 Carotenoid (mg/ml) Cell Growth (OD 570 ) 0 1 2 3 4 5 6 7 0.30.60.9 IPTG concentration (mM)

17. Bacterial Artificial Chromosome (BAC) oriV oriS par Tn1000 flm ccd rep FIB rep FIA 53443454864 kb Native F plasmid of Escherichia coli EE E BP H F plasmid 0 25 50 75

18. BACs are stable indefinitely in the absence of selection pressure 04080120160 0 0.2 0.4 0.6 0.8 1 Culture time (generations) Fraction plasmid- bearing cells Gene expression induced Not induced

19. Commonly-used high-copy plasmids are segregatively unstable 0 0.2 0.4 0.6 0.8 1 04080120160 Culture time (generations) Fraction plasmid- bearing cells Gene expression induced Not induced

20. The auxiliary chromosomes have improved control of gene expression Uninduced Expression Induced Expression Growth Rate of Host BAC High-Copy Plasmid 0.69 hr -1 0.53 hr -1 15 units 200 units 4,000 units 12,500 units

21. dxs expressed from a bacterial artificial chromosome P const crtEcrtIcrtY Pyr + G3P FPP DXS Carotenoids CrtE CrtI CrtY Bacterial artificial chromosome P BAD araC dxs IPP DMAPP

22. Carotenoid production in cells expressing dxs from a BAC Cell growth (OD 600nm ) Lycopene (mg/ml) Arabinose concentration (mM) 0.0 2.0 4.0 6.0 8.0 10.0 00.0130.1331.3313.3

23. Carotenoid production in cells expressing dxs

24. Gene expression tools for metabolic engineering Reproducible promoter control

25. inside outside P BAD gfp PCPC araC araE P araE The arabinose-inducible P BAD promoter Chromosome Plasmid

26. inside outside P BAD gfp PCPC araC araE P araE Chromosome Plasmid Green Fluorescent Protein arabinose A A AA The arabinose-inducible P BAD promoter

27. Expression of gfp from the arabinose-inducible promoter 100 1000 10000 100000 0.000010.00010.0010.010.1110 Arabinose (wt %) Fluorescence/OD 600

28. Varying gene expression levels by varying induction in individual cells Inducer concentration Average gene expression

29. Varying gene expression levels by varying the number of induced cells Inducer concentration Average gene expression

30. Flow cytometric analysis Fluorescence Frequency Fluorescence detector FALS sensor Laser

31. Varying gene expression levels by varying the number of induced cells Fluorescence Frequency Fluorescence Frequency Fluorescence Frequency

32. Varying gene expression levels by varying induction in individual cells Frequency Fluorescence Frequency Fluorescence Frequency

33. Native arabinose-inducible system gives rise to two populations Increasing inducer concentration Fluorescence intensity

34. All-or-None Pathway Control IPPDMAPP GPP FPP Amorphadiene Artemisinin Pyruvate IPPDMAPP GPP FPP Amorphadiene Artemisinin Pyruvate

35. inside outside P BAD PCPC araC araE P con GFP gfp arabinose The arabinose-inducible P BAD promoter

36. Population analysis of engineerined E. coli expressing gfp Increasing inducer concentration Fluorescence intensity

37. Regulated Pathway Control IPPDMAPP GPP FPP Amorphadiene Artemisinin Pyruvate IPPDMAPP GPP FPP Amorphadiene Artemisinin Pyruvate

38. Gene expression tools for metabolic engineering Expression of multiple genes

39. Balancing enzymatic reactions in the cell C A B X Y1 Z Enzyme 1 Enzyme 3 Enzyme 2 Enzyme 4 Y2 gene 3 gene 4 gene 2 gene 1

40. Using individual control elements C A B X Y1 Z Enzyme 1 Enzyme 3 Enzyme 2 Enzyme 4 Y2 gene 4 P4P4 P1P1 gene 1 P3P3 gene 3 P2P2 gene 2

41. Synthetic operons C A B X Y1 Z Enzyme 1 Enzyme 3 Enzyme 2 Enzyme 4 Y2 gene 3 gene 4 P gene 2 gene 1 mRNA DNA

42. C A B XY1Z Enzyme 1Enzyme 3 Enzyme 2 Enzyme 4 Y2 mRNA RNase

43. Secondary structures in the mRNA protect natural mRNAs against nucleases RNase E endonuclease exonuclease RBS ribosome

44. tccatacgtcgacggtaccgtattttggatgataacgaggcgcaaaaaatg aggtatgcagctgccatggcataaaacctactattgctccgcgttttttac A cassette system to design mRNA stability lacZ Sal I Asp718 Insertion of hairpin cassette tccatacgtcgacttatctcgagtgagatattgttgacggtaccgtattttggatgataacgaggcgcaaaaaatg aggtatgcagctgaatagagctcactctataacaactgccatggcataaaacctactattgctccgcgttttttac Transcription gguaccguauuuuggaugauaacgaggcgcaaaaaug ga a c c c c c c u u u u u u g g g g g g a a a a a u u u u u g a ggagtcgacttatctcgagtgagatattgttgacggtaccccg cctcagctgaatagagctcactctataacaactgccatggggc Sal I Asp718

45. A family of synthetic hairpins acgucgacagguaccguauuuu t 1/2 = 2.6 min pTC40 c c c c u u u u g g g a a u ga c c u g g g a u u a g a gguaccguauuuu t 1/2 = 4.9 min pHP14 c c c c a u u g g g au u a g a gguaccguauuuu u u u a g c c a a g u c u u a u a t 1/2 = 2.1 min pHP15 t 1/2 = 6.1 min c c c c c c u u u u u u g g g g g a a a a a u u u u a g a g ga u gguaccguauuuu cg ua pHP8 c c c c c c u u a u u g g g g g g g a a a a a a u u u u u a g a gguaccguauuuu t 1/2 = 6.8 min pHP10 c c c c u a u u g g g a a u c c u u g g g g a a a a u u u u a g a gguaccguauuuu t 1/2 = 5.5 min pHP9 c c c c c c u u u u u u g g g g g g g a a a a a a u u u u u a g a gguaccguauuuu t 1/2 = 8.3 min pHP4 t 1/2 = 19.8 min pHP17 a c c c c a u u g g g au u g a gguaccguauuuu g c g a g a u c c a a u g u a a t u u u ua ua c u g a g c t 1/2 = 12.5 min pHP16 c c c c c c u u u u u u g g g g g g g a a a a a a u u c u u a g a gguaccguauuuu c u u c u g c a g a g u u u a

46. A synthetic operon for carotenoid production PhytoeneLycopene  -Carotene p70yHPxi RNase E site HPx HP CrtECrtICrtY crtYcrtI 3'

47. HP PhytoeneLycopene  -Carotene CrtECrtICrtY 3' 5' HP16 5' 3' crtY crtI 3' 5'

48. Variation in hairpins p70yi crtYcrtI 3' 5' RNase E site p70yHP17i crtYcrtI 3' 5' HP17 p70yHP4i crtY crtI 3' 5' HP4 p70yHP16i crtY crtI 3' 5' HP16

49. Relative levels of carotenoids 0 100 200 300 400 p70yip70yHP4ip70yHP16ip70yHP17i  -carotene/lycopene PhytoeneLycopene  -Carotene CrtECrtICrtY

50. Synthesis of artemisinin in cells Clone the genes Artem. FPP

51. Poor performance of plant sesquiterpene cyclases Low yields: 0.05 to 0.7 ng/mL/OD Expression of rare E. coli codon tRNA did not much help Martin et al., Biotech. Bioeng. 2001 5-epi-aristolochene Cadinene Vetispiradiene

52. Amorphadiene and artemisinin biosynthetic pathway

53. Take gene sequence from patent Optimize sequence for expression in desired host Synthesize 84 oligonucleotides of ~40 basepairs each Assemble into complete gene using the polymerase chain reaction (PCR) Assembly of rcAmorphadiene Cyclase

54. Amorphadiene production by the synthetic amorphadiene cyclase 142-fold improvement over other native cyclases (100 ng/mL/OD)

55. Synthesis of artemisinin in cells Supply of intracellular precursors

56. DXP pathway Dimethylallyl Pyrophosphate (DMAPP) 4-diphosphocytidyl-2C-methyl- D-erythritol-2-phosphate IspD IspF IspE Pyruvate 1-deoxy-D- xylulose-5- phosphate (DXP) 2C-methyl-D- erythritol-4- phosphate (MEP) 4-diphospho-2C- methyl-D-erythritol 2C-methyl-D- erythritol 2,4-cyclodiphosphate Isopentenyl Pyrophosphate (IPP) D-glyceraldehyde- 3-phosphate (G3P) pyridoxine thiamine 1-hydroxy-2-methyl- 2-(E)-butenyl 4- diphosphate IspG IspH Dxr Dxs

57. Expression of genes known to limit production IPPDMAPP FPP Amorphadiene PyruvateG3P DXS IdI IspA

58. Amorphadiene production by the synthetic amorphadiene cyclase Additional 3-fold (300 ng/mL/OD)

59. Intermediates in the DXP pathway are necessary for growth IPPDMAPP GPP FPP GGPP Carotenoids Diterpenes Sesquiterpenes Monoterpenes PyruvateG3P DXP Pathway pyridoxine thiamine

60. Mevalonate pathway

61. (1.2kb) (1.5kb) (1.6kb) Acetyl-CoA Construction of synthetic mevalonate pathway operons P HMGS tHMGR atoB MevT Mevalonate IPP DMAPP MBI (1.3kb) (1.2kb) P PMK MPD MK idi (0.5kb) Mevalonate

62. 30-fold improvement (3 mg/L/OD) Mevalonate pathway DXP pathway Amorphadiene from the full mevalonate pathway

63. Amorphadiene production in a two-phase fermentation

64. Expression of plant mono-, sesqui-, and di-terpenes cyclases in E. coli Vetispiradiene Hyoscyamus muticus  -cadinene cotton 5-epi-aristolochene Tobacco FPP Sesquiterpenes Casbene cyclase Castor bean ent-Kaurene cyclase fungi GGPP Diterpene Myrcene synthase Arabidopsis thaliana GPP Monoterpene

65. Design Rules for Doing Chemistry in Bacteria Low copy number is generally better for reconstituting metabolic pathways Consistent promoter control is essential for product and pathway homogeneity Construction of operons and the use of mRNA stability is an efficient way to coordinate expression of multiple genes Imbalances in gene expression can cause accumulation of intermediates and can be toxic to cells

66. Acknowledgements Funding National Science Foundation Office of Naval Research Maxygen Diversa University of California Discovery Grant Graduate Students Trent A. Carrier Kristala Jones Christina Smolke Doug Pitera Sydnor Withers Brian Pfleger Yasuo Yoshikuni Post-docs Artem Khlebnikov Seon-Won Kim Vincent Martin Jack Newman Kinkead Reiling