1. http://cs273a.stanford.edu [Bejerano Fall10/11] 1

2. 2 Lecture 11 HW1 Feedback (ours) (Upcoming Project – discuss Wed) Non-Coding RNAs Halfway Feedback (yours)

3. http://cs273a.stanford.edu [Bejerano Fall10/11] 3 “non coding” RNAs

4. 4 Central Dogma of Biology:

5. 5 RNA is an Active Player: reverse transcription long ncRNA

6. 6 What is ncRNA? Non-coding RNA (ncRNA) is an RNA that functions without being translated to a protein. Known roles for ncRNAs: –RNA catalyzes excision/ligation in introns. –RNA catalyzes the maturation of tRNA. –RNA catalyzes peptide bond formation. –RNA is a required subunit in telomerase. –RNA plays roles in immunity and development (RNAi). –RNA plays a role in dosage compensation. –RNA plays a role in carbon storage. –RNA is a major subunit in the SRP, which is important in protein trafficking. –RNA guides RNA modification. –In the beginning it is thought there was an RNA World, where RNA was both the information carrier and active molecule.

7. 7 AAUUGCGGGAAAGGGGUCAA CAGCCGUUCAGUACCAAGUC UCAGGGGAAACUUUGAGAUG GCCUUGCAAAGGGUAUGGUA AUAAGCUGACGGACAUGGUC CUAACCACGCAGCCAAGUCC UAAGUCAACAGAUCUUCUGU UGAUAUGGAUGCAGUUCA RNA Folds into (Secondary and) 3D Structures Cate, et al. (Cech & Doudna). (1996) Science 273:1678. Waring & Davies. (1984) Gene 28: 277. We would like to predict them from sequence.

8. RNA structure rules Canonical basepairs: –Watson-Crick basepairs: G - C A - U –Wobble basepair: G – U Stacks: continuous nested basepairs. (energetically favorable) Non-basepaired loops: –Hairpin loop. –Bulge. –Internal loop. –Multiloop. Pseudo-knots

9. Bafna1 RNA structure: Basics Key: RNA is single-stranded. Think of a string over 4 letters, AC,G, and U. The complementary bases form pairs. Base-pairing defines a secondary structure. The base-pairing is usually non-crossing.

10. Ab initio structure prediction: lots of Dynamic Programming Maximizing the number of base pairs (Nussinov et al, 1978) simple model:  (i, j) = 1

11. Pseudoknots drastically increase computational complexity

12. http://cs273a.stanford.edu [Bejerano Fall10/11] 12 Nearest Neighbor Model for RNA Secondary Structure Free Energy at 37 O C: Mathews, Disney, Childs, Schroeder, Zuker, & Turner. 2004. PNAS 101: 7287.

13. Zuker’s algorithm MFOLD: computing loop dependent energies

14. http://cs273a.stanford.edu [Bejerano Fall10/11] 14 Energy Landscape of Real & Inferred Structures

15. 1 Unfortunately… – Random DNA (with high GC content) often folds into low-energy structures. – What other signals determine non-coding genes?

16. http://cs273a.stanford.edu [Bejerano Fall10/11] 16 Evolution to the Rescue

17. http://cs273a.stanford.edu [Bejerano Fall10/11] 17

18. a a cg u uc c u c ua g acc S S S S S  aSu L  aL S  uSaL  cL S  gSc L  a S  cSgL  c S  L Each derivation tree corresponds to a structure. Stochastic context-free grammar (SCFG) L L L L

19. S  aSu S  cSg S  gSc S  uSa S  a S  c S  g S  u S  SS 1. A CFG S  aSu  acSgu  accSggu  accuSaggu  accuSSaggu  accugScSaggu  accuggSccSaggu  accuggaccSaggu  accuggacccSgaggu  accuggacccuSagaggu  accuggacccuuagaggu 2. A derivation of “accuggacccuuagaggu” 3. Corresponding structure Stochastic context-free grammar (cont’)

20. http://cs273a.stanford.edu [Bejerano Fall10/11] 20

21. http://cs273a.stanford.edu [Bejerano Fall10/11] 21 MicroRNA

22. Genomic context known miRNAs in human intergenicintronic polycistronic monocistronic

23. tRNA

24. tRNA Activity

25. http://cs273a.stanford.edu [Bejerano Fall10/11] 25

26. http://cs273a.stanford.edu [Bejerano Fall10/11] 26

27. http://cs273a.stanford.edu [Bejerano Fall10/11] 27 Human specific accelerated evolution Chimp Human rapid change conserved

28. 28 Human Accelerated Regions Human-specific substitutions in conserved sequences 28 [ Pollard, K. et al., Nature, 2006] [Beniaminov, A. et al., RNA, 2008] Human Derived Chimp Human rapid change HAR1: Novel ncRNA Co-expressed in Cajal-Retzius cells with reelin. Similar expression in human, chimp, rhesus. 18 unique human substitutions leading to novel conformation. All weak (AT) to strong (GC). conserved Chimp Ancestral

29. http://cs273a.stanford.edu [Bejerano Fall10/11] 29 Other Non Coding Transcripts

30. http://cs273a.stanford.edu [Bejerano Fall10/11] 30

31. http://cs273a.stanford.edu [Bejerano Fall10/11] 31 mRNA

32. http://cs273a.stanford.edu [Bejerano Fall10/11] 32 EST

33. lincRNAs (long intergenic non coding RNAs) http://cs273a.stanford.edu [Bejerano Fall10/11] 33

34. X chromosome inactivation in mammals X XX Y X Dosage compensation

35. Xist – X inactive-specific transcript Avner and Heard, Nat. Rev. Genetics 2001 2(1):59-67

36. http://cs273a.stanford.edu [Bejerano Fall10/11] 36 Microarrays, Next Gen(eration) Sequencing etc.

37. http://cs273a.stanford.edu [Bejerano Fall10/11] 37 End Results

38. http://cs273a.stanford.edu [Bejerano Fall10/11] 38

39. http://cs273a.stanford.edu [Bejerano Fall10/11] 39

40. http://cs273a.stanford.edu [Bejerano Fall10/11] 40 Transcripts, transcripts everywhere Human Genome Transcribed (Tx) Tx from both strands Leaky tx? Functional?

41. Or are they? http://cs273a.stanford.edu [Bejerano Fall10/11] 41

42. http://cs273a.stanford.edu [Bejerano Fall10/11] 42 Halfway Feedback