1. From Extraction to Information
DNA Sequencing
From Extraction to Information
I’m going to talk to you about the process of dna sequencing.
So, that includes how we are able to take a biological sample, extract its dna, and then target a specific region of the dna molecule to determine its sequence.
You’ve already extracted dna from coral bacteria and amplified its 16s gene. So I’m going to recap these processes that you’ve already done, then take you through the process that actually determines the sequence of the gene.

2. The Process Step 1: DNA Extraction Step 2: PCR Amplification
Genomic DNA extraction from the organism (bacteria)
Step 2: PCR Amplification
Amplification of the DNA segment of interest (16S gene)
Step 3: DNA Sequencing
Sequencing of the PCR product (amplified 16S gene)
The process of sequencing a gene can be broken down into 3 general steps:
First step is to extract the genomic dna from the organism.
2nd step is to make more copies of the dna segment you are interested in using pcr.
The final step is to use the amplified dna product to determine the sequence of the gene.

3. Step 1: DNA Extraction DNA Cells DNA Extraction with DNA
So here are your bacteria cells with the dna in them.
And the goal of dna extraction is to remove the complete genome from the cell.
DNA
Cells
with DNA

4. Step 2: PCR Amplification
Target Gene
PCR Product
(Amplified
Target Gene)
Target Gene
PCR
Amplification
Then once you have the dna molecule isolated,
You want to find the specific region you are interested in, called the target gene
And make many copies of it.
DNA

5. Step 3: DNA Sequencing PCR product Sequence of Target Gene
(Amplified
Target Gene)
Sequence of
Target Gene
DNA Sequencing
AGCTGCTAAGCTTG
AGCTTGCACAAGCT
TAGCTTGCAAGCTT
AGCTTGCAAGCTTG
CAAGCTTGCAAGCT
TGCAAGCTTGCAAG
CTTGCAACGTTGCA
AAGCTTGCAAGCTA
Once you have generated enough copies of your gene,
You an take it through the sequencing process to determine its exact sequence.

6. Chapter 1: DNA Extraction
Now lets go into more detail for each of the steps.

7. The Cell and its Components
DNA (1%)
phospholipids (2%)
30% chemicals
polysaccharides (2%)
Ions, small molecules (4%)
RNA (6%)
70% H2O
Here is your bacteria cell:
Made up of mostly water and
30% biochemicals like protein etc, notice dna is present in the smallest amount
proteins (15%)

8. Three basic steps of DNA extraction
Disruption of cell and lysis
Removal of proteins and other biochemicals
Recovery of DNA
So to isolate the dna from the cell you have to rupture the cell membrane
Take away all of the other biochemicals in the cell (like protiens, etc.)
While still retaining high quality dna.

9. Disruption of cell and lysis
Cells are broken down into components using a Lysis Buffer containing:
EDTA: disrupts cell membrane and inhibits DNases
SDS: denatures proteins and solubilizes cell membranes
Proteinase K: breaks down proteins
RNase A: breaks down RNA
Solution is incubated at 55ºC 1-3 hours (or overnight)
To do this we incubate the cells in a lysis buffer that contains among other things edta, sds, prok, and rnase a.
Each of these chemicals plays a very important function as we’ll see more clearly in the next slide.
This solution is incubated at 55degrees for 1-3 hours or overnight.

10. Disruption of cell and lysis
DNA
RNA
proteins
lipids
ions +
Here is the bacterial cell.
The edta and sds will help to rupture the cell membrane causing everything to spill out.
We want to get rid of everything but the dna since these biochemicals will inhibit the pcr process, so the rnase a, pro k, sds will chop up the large molecules and the edta will bind to the free ions which will prevent any enzymes from digesting the dna. This will ensure we will retain high-quality dna + + +
EDTA
RNase A
Proteinase K
SDS
EDTA

11. Disruption of cell and lysis
After lysis, cell extract contains DNA, proteins, and other chemicals/biochemicals
cell extract

12. Removal of proteins and biochemicals
Solid phase binding (silica membrane)
Cell extract is applied to a silica membrane column
DNA binds to membrane
all other molecules flow through and are removed
DNA bound
to membrane
The simplest way to remove the other biochemicals is to use a purification kit that employs solid phase binding.
Cell extract is applied to the membrane in the column.
The dna binds to the membrane and all other molecules are rinsed away.
Silica
membrane
centrifugation
cell extract
flow-thru

13. Recovery of DNA Elution of silica membrane:
a low-salt buffer or water is added to the membrane
bound DNA falls off of the membrane
elution
add water
(or buffer)
DNA bound
to membrane
To recover the dna, a low salt buffer or water is added to the membrane
Spun down
And the dna is recovered in solution.
centrifugation
DNA
in solution

14. Review Step 1: DNA Extraction
So to recap: We extract the DNA through:
-disruption and lysis of the cell
-removal of proteins and other biochemicals
-recovery of DNA using silica-membrane binding
DNA
Cells
with DNA

15. Chapter 2: PCR Amplification
Now that we have isolated the dna from the cell, we want to find our target gene and amplify it.

16. Step 2: PCR Amplification
Target Gene
PCR Product
(Amplified
Target Gene)
Target Gene
PCR
Amplification
Here again is the basic game plan of pcr-amplification step of the sequencing process.
DNA

17. Part I: DNA Polymerization
to Fully understand how the amplification step works, Let’s review what it means to copy and
synthesize dna.

18. DNA Building Block base P P P OCH2 O sugar H H OH H5’
OCH2 O
sugar 4’ 1’ H
phoshpate groups H 3’ 2’ OH H
This is a nucleotide or the building block of the dna molecule. It comes in four different types: a,c,g,t depending on the base.
The order of these nucleotides is what makes up the sequence of a gene.
deoxyribose nucleotide triphosphate (dNTP)

19. DNA Polymerization: Basics
Existing DNA Strand O P O G O P O C O P O T
Phosphodiester bond O H
dNTP P P P O T
Here is a general look at what happens when a dna molecule is being synthesized:
There is an existing dna strand
Then an unbound dntp is added to the strand by a phosphodiester bond at the 3 prime place on the sugar ring. Two of the phospate groups will fall away and the remaining one will form the link between the two sugar molecules O H P P P O A O H P P P O C O H

20. DNA Polymerization The synthesis of DNA requires: DNA template
Primer: short oligonucleotide necessary for DNA polymerase to start
DNA polymerase: enzyme that constructs the DNA chain
deoxyribonucleotide triphosphates (dNTPs): building blocks of DNA A C C G G G A A G C C C C G G A T G A
DNA
polymerase A C
So this is what is required for that polymerization to occur:
A dna template that acts as a guideline for the order that the dntps will be added in. G T
DNA
polymerase G A T G A G T T C G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C T T C G G G G C C T A C T C A A G C A C A G G C A T G T T G A C C G C A T T A G T A C C G G G A A G C C C C G

21. DNA Replication Review
Step 1: Denaturation: separation of the two strands of the DNA duplex
Gyrase pulls apart the strands creating a “replication bubble”
Helicase travels down DNA molecule, breaking the hydrogen bonds that hold the two strands together
So this is what actually takes place in a cell when dna molecules need to be synthesized.
Two enzymes denature or separate the two complementary strands of the dna molecule.
Gyrase pulls apart the strands, then helicase travels down the dna molecule , breaking the hydrogen bonds that held the molecule together
helicase
gyrase
helicase G A T G A G T T C G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C T T C G G G G C C T A C T C A A G C A C A G G C A T G T T G A C C G C A T T A G T A C C G G G A A G C C C C G
gyrase

22. DNA Replication Review
Step 2: Annealing of primers to the DNA template strand
Primase synthesizes small complementary strands of RNA (“primers”) to the single strands of the DNA template
Next an enzyme called primase makes short complementary strands of rna to the single strands of dna template. We can call these primers.
primase G A T G A G T T C G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C T T C G G G G C G C C C C G
primase G A T G A G C T A C T C A A G C A C A G G C A T G T T G A C C G C A T T A G T A C C G G G A A G C C C C G

23. DNA Replication Review
Step 3: Extension of newly constructed complementary DNA molecules
DNA polymerase adds bases to the ends of the primers, constructing an exact copy of the template
Dna polymerase adds new dntps to the ends of the primers based on the specific binding of the bases to each other. A can only pair with t and c only with g. Therefore it is able to create an exact copy of the template strand.
DNA
polymerase G A T G A G T T C G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C T T C G G G G C C T A C T C A A G C A C A G G C A T G T T G A C C G C A T T A G T A C C G G G A A G C C C C G
DNA
polymerase G A T G A G T T C G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C T T C G G G G C C T A C T C A A G C A C A G G C A T G T T G A C C G C A T T A G T A C C G G G A A G C C C C G

24. DNA Replication Review
Another DNA Polymerase replaces the RNA primer with dNTPs
The final result: two copies of replicated DNA
DNA
polymerase G A T G A G T T C G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C T T C G G G G C C T A C T C A A G C A C A G G C A T G T T G A C C G C A T T A G T A C C G G G A A G G C C C C C C C C G G
DNA
polymerase G G A A T T G G A A G G T T C G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C T T C G G G G C C T A C T C A A G C A C A G G C A T G T T G A C C G C A T T A G T A C C G G G A A G C C C C G

25. Polymerization Mg2+ ions dNTPs DNA Polymerase Primer DNA TemplateC O P G O P T O P T O P C O P G O P A O P
Mg2+
ions
4) dNTPs
dNTPs
5) Mg2+ ions
DNA Polymerase
Primer
DNA
Polymerase
Phosphodiester bond A O P T G C
Here’s a more detailed look at the process of dna synthesis.
Here is a structure of a dna template.
And a structure of the primer. Notice the a-t and g-c pairings.
The dna polymerase attaches to the end of the primer and adds the appropriate dntps to the primer based on the template strand and with the help of magnesium, attaches them using phosphodiester bonds T P O C G A
DNA Template

26. Part II: PCR
Now that we’ve reviewed dna polymerization within a cell, lets see how it compares to polymerization using synthetic means, otherwise known as the polymerase chain reaction.

27. The Polymerase Chain Reaction
Polymerase Chain Reaction: cycling process consisting of the same 3 steps of DNA replication, with some differences:
temperature cycling removes the need for other enzymes (gyrase/helicase, or primase)
PCR uses pre-made oligonucleotide DNA primers
DNA
polymerase
gyrase
primase T C A G
helicase T A G C

28. The Polymerase Chain Reaction
During PCR, a thermocycler brings the reaction mix to 3 different temperatures analagous to the 3 steps of DNA replication
Denaturation (94˚C) of the DNA template by heat
Annealing (37˚-70˚C) of the primers to the template
Extension (72˚C) of the DNA strand by DNA polymerase
These steps are repeated for 25 to 30 cycles
94˚C
65˚C
72˚C
denaturation
annealing
extension

29. Thermocycler Program Initial Denaturation: 94˚C 2 min Start Cycle
Denaturation 94˚C 30 sec
Annealing 65˚C 30 sec
Extension 72˚C 30 sec
Repeat Cycle 29 times (total = 30 cycles)
Final Extension 72˚C 7 min
Hold 4˚C ∞

30. Denaturation Denaturation occurs at 94˚C
The high temperature is used to break down the hydrogen bonds that hold the two strands together
94˚C G A T G A G T T C G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C T T C G G G G C C T A C T C A A G C A C A G G C A T G T T G A C C G C A T T A G T A C C G G G A A G C C C C G

31. Annealing Annealing occurs at 37˚-70˚C 94˚C 65˚C
Oligonuclotide DNA primers anneal to their complementary sequences on the template strands
Annealing temperature depends on the melting temperature (Tm) of the primer (dependent on base composition)
94˚C
65˚C G A T G A G T T C G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C T T C G G G G C T A G C T C A G C T A C T C A A G C A C A G G C A T G T T G A C C G C A T T A G T A C C G G G A A G C C C C G

32. Extension Extension occurs at 72˚C
DNA polymerase attaches to the primers and extends the new DNA strand
The 3 steps (denaturation, annealing, and extension) are repeated for another 24 to 29 cycles
65˚C
72˚C
DNA
polymerase G A T G A G T T C G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C T T C G G G G C C T A C T C A A G C A C A G G C A T G T T G A C C G C A T T A G T A C
DNA
polymerase T C A G T A C A A C T G G C G T A A T C A T G G C C C T T C G G G G C C T A C T C A A G C A C A G G C A T G T T G A C C G C A T T A G T A C C G G G A A G C C C C G

33. Target Sequence A desired target sequence is identified
To isolate the target sequence, primers that flank the region must be constructed
The DNA segment that is then amplified contains the region of interest
Template DNA
Forward Primer
Reverse Primer
Target Sequence of interest
PCR Product

34. PCR: Cycle 1 Annealing Denaturation Extension 4
DNA Copies 4
Target Copies
Target Sequence of interest

35. PCR: Cycle 2 Annealing Denaturation Extension 8 2 DNA Copies
Target Copies 2

36. PCR: Cycle 3 Annealing Denaturation Extension 16 8 DNA Copies
Target Copies 8

37. PCR: Cycle 4 Annealing Extension Denaturation 32 22 DNA Copies
Target Copies 22

38. PCR: Cycle 5 Annealing Extension Denaturation 64 52 DNA Copies
Target Copies 52

39. PCR Amplification: First 10 cycles

40. PCR Amplification: First 15 cycles

41. PCR Amplification: After 30 cycles

42. PCR Amplification: After 30 cycles
Target Copies 1 16
65,504 2 17
131,038 3 18
262,108 4 8 19
524,250 5 22 20
1,048,536 6 52 21
2,097,110 7
114
4,194,260
240 23
8,388,562 9
494 24
16,777,168 10
1,004 25
33,554,382 11
2,026 26
67,108,812 12
4,072 27
134,217,674 13
8,166 28
268,435,400 14
16,356 29
536,870,854 15
32,738 30
1,073,741,764

43. Review Step 1: DNA Extraction
Cells
with DNA

44. Review Step 2: PCR Amplification
Target Gene
PCR Product
(Amplified
Target Gene)
Target Gene
PCR
Amplification
DNA

45. Chapter 3: DNA Sequencing

46. deoxyribose NTP (dNTP)
Nucleotides
BASE
BASE P P P
OCH2 P P P
OCH2 O O H H H H OH H OH OH
ribose NTP (NTP)
(Makes up RNA)
deoxyribose NTP (dNTP)
(Makes up DNA)
These are the different nucleotides often seen in molecular biology.
BASE P P P
OCH2 O H H H H
dideoxyribose NTP (ddNTP)

47. DNA Sequencing Dideoxy method of DNA sequencing (Sanger Method)
Single-stranded DNA to be sequenced serves as a template strand for DNA synthesis
single primer is used for DNA synthesis initiation
use of dNTPs along with labeled ddNTPs
BASE
BASE P P P
OCH2 P P P
OCH2 O O H H H H OH H H H
dNTP
ddNTP

48. DNA Polymerization using ddNTPsC P O C O O P O T P O C O H O H P P P O T P P P O T O H H P P P O A P P P O A O H O H P P P O C
Chain Termination O H

49. Sequence Reaction BigDye Terminator v3.1 Sequencing:
a Dye Terminator Cycle Sequencing Master Mix is used for sequencing reaction.
Components include:
DNA polymerase I, Mg2+, buffer
dNTPs in ample quantities:
(dATP, dTTP, dCTP, dGTP)
ddNTPs in limited quantities, each labeled with a “tag” that fluoresces a different “color”:
(ddATP, ddTTP, ddCTP, ddGTP)

50. The Polymerase Chain Reaction
PCR makes use of a thermocycler to bring the reaction mix to three different temperatures
Denaturation (94˚C) of the DNA template by heat
Annealing (37˚-70˚C) of the primers to the template
Extension (72˚C) of the DNA strand by DNA polymerase
These steps are repeated for 25 to 30 cycles
94˚C
65˚C
72˚C
denaturation
annealing
extension

51. Sequencing Reaction
Sequencing reaction is a cycled reaction using a thermocycler (as in the Polymerase Chain Reaction)
Like PCR, it consists of 3 steps:
Denaturation, Annealing, Extension;
these 3 steps are repeated for 30 cycles
Unlike PCR, it involves a single primer and labeled ddNTPs
extension proceeds normally until, by chance, DNA polymerase inserts a ddNTP, terminating the chain

52. Sequencing Reaction G A A C T C G G G T T T G G G T T T C C C C C C G
DNA
polymerase G A A C T C G G G T T T G G G T T T C C C C C C G G G T T T A A A C C C A A A A A A C C C T T T G G G G G G C C C G G G T T A A A A T T C A T G G C C C T T C G C T A C T C A A G C A C A G G C A T G T T G A C C G C A T T A G T A C C G G G A A G C C C C G

53. Sequencing Reaction G T G T C C G T A C A A C T G G C G T A A T C A T
DNA
polymerase G A A C T C C T A C T C A A G C A C A G G C A T G T T G A C C G C A T T A G T A C C G G G A A G C C C C G

54. Sequencing Reaction G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C T T C G G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C T T C G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C T T G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C T G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C G T G T C C G T A C A A C T G G C G T A A T C A T G G C C G T G T C C G T A C A A C T G G C G T A A T C A T G G C G T G T C C G T A C A A C T G G C G T A A T C A T G G G T G T C C G T A C A A C T G G C G T A A T C A T G G T G T C C G T A C A A C T G G C G T A A T C A T G T G T C C G T A C A A C T G G C G T A A T C A G T G T C C G T A C A A C T G G C G T A A T C
So when we line up the various fragments according to size, we can start to see how we will be able to see the order of the bases within our target gene. G T G T C C G T A C A A C T G G C G T A A T G T G T C C G T A C A A C T G G C G T A A G T G T C C G T A C A A C T G G C G T A G T G T C C G T A C A A C T G G C G T G T G T C C G T A C A A C T G G C G
DNA
polymerase G A A C T C C T A C T C A A G C A C A G G C A T G T T G A C C G C A T T A G T A C C G G G A A G C C C C G

55. Applied Biosystems 3130xl Genetic Analyzer
16-channel capillary electrophoresis capable of various genomic analysis functions
The machine able to detect the fluorescent ddntps and assort the reaction fragments according to size is called the 3130xl genetic analyzer.

56. Capillary Electrophoresis
the sequencing reactions are loaded into the ABI3130xl
Samples are taken up by capillaries containing polyacrylamide gel (Performance Optimized Polymer (POP-7)
Fragments are separated by length from shortest to longest by electrophoresis
Detector
In this machine each sequencing reaction is loaded into its own well. And one capillary is designeated for each well. The sample is taken up into the capillary that is filled with a polyacrylamide gel.
And the fragments are separated by length from shortest to longest by electrophoresis - +
Capillary array
Laser
Samples

57. Electrophoresis
Electrophoresis is a technique used to separate DNA or protein molecules on the basis of size and charge
Typical method used for analyzing, identifying and purifying DNA fragments

58. Movement in an Electric Field
The mobility of molecules in the electrical field is also affected by their overall size or molecular weight
Lower
Molecular
weight
Higher
Molecular
weight –
Agarose gel +

59. DNA Gel Electrophoresis
These “markers” are run alongside samples,
Helps determine the length of the PCR sample
DNA fragments of the same length will migrate through the gel at the same rate
1500bp
1200bp
1100bp
1000bp
900bp
1050bp
800bp
820bp
700bp
600bp
650bp
500bp
400bp
400bp
300bp
200bp
280bp
100bp

60. Electrophoresis - As the sample travels through the capillaries +
Shorter fragments have less resistance and migrate faster
Longer fragments have more resistance and move slower
So using this same principle, the shorter reaction fragments will move quicker than the longer fragments and the fragments will assort themselves according to size. - +

61. Fluorescense detection
As fragments pass through detector window, the fluorescent “tag” of the ddNTP is excited by a laser
The emission of the “tag” is picked up by a detector and is translated to a colored peak unique to the nucleotide A G C T

62. Sequencing Reaction G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C T T C G G T G T C C G T A C A A C T G G C G G T G T C C G T A C A A C T G G C G T A A T G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C T T G T G T C C G T A C A A C T G G C G T G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C T T C G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C T G T G T C C G T A C A A C T G G C G T A A T C A G T G T C C G T A C A A C T G G C G T A A T C A T G G C C C G T G T C C G T A C A A C T G G C G T A A T C G T G T C C G T A C A A C T G G C G T A A T C A T G G G T G T C C G T A C A A C T G G C G T A G T G T C C G T A C A A C T G G C G T A A T C A T G G C
So you take your sequencing reaction with its varied fragment lengths G T G T C C G T A C A A C T G G C G T A A G T G T C C G T A C A A C T G G C G T A A T C A T G G C C G T G T C C G T A C A A C T G G C G T A A T C A T G T G T C C G T A C A A C T G G C G T A A T C A T G
DNA
polymerase G A A C T C C T A C T C A A G C A C A G G C A T G T T G A C C G C A T T A G T A C C G G G A A G C C C C G

63. Capillary Electrophoresis
As the sample travels through the capillaries
Shorter fragments have less resistance and migrate faster
Longer fragments have more resistance and move slower
You pass them through an electrical field in the capillary where they will assort themselves according to size, shorter fragments first. - +

64. Detection of fluorescent tags
Then the fragments will pass through the detection window in the machine in order of size, and the fluorescence of the ddntps will be recorded in the computer software.

65. Final Data
The final data generated is the complete chromatogram and the text version of the DNA sequence
And in the software, the final data is generated as this image called a chromatogram as well as a text version.
ACAACTGGCGTGAATCATGGCCCTTCGGGGCCATTGTTTCTCTGTGGAGGAGTGCCATGACGAAAGATGAACTGATTGCCCGTCTCCGCTCGCTGGGTGAACAACTGAACCGTGATGTCAGCCTGACGGGGACGAAAGAAGAACTGGCGCTCCGTGTGGCAGAGCTGAAAGAGGAGCTTGATGACACGGATGAAACTGCCGGTCAGGACACCCCTCTCAGCCGGGAAAATGT

66. Review Step 1: DNA Extraction
Cells
with DNA

67. Review Step 2: PCR Amplification
Target Gene
PCR Product
(Amplified
Target Gene)
Target Gene
PCR
Amplification
DNA

68. Review Step 3: DNA Sequencing
PCR product
(Amplified
Target Gene)
Sequence of
Target Gene
DNA Sequencing
AGCTGCTAAGCTTG
AGCTTGCACAAGCT
TAGCTTGCAAGCTT
AGCTTGCAAGCTTG
CAAGCTTGCAAGCT
TGCAAGCTTGCAAG
CTTGCAACGTTGCA
AAGCTTGCAAGCTA

69. BWET.PL4.8F Sequence

70. BWET.PL4.8F Sequence
GCAGTCGAGCGGAACGAGTTATCTGAACCTTCGGGGAACGATAACGGCGTCGAGCGGCGGACGGGTGAGTAATGCCTGGGAAATTGCCCTGATGTGGGGGATAACCATTGGAAACGATGGCTAATACCGCATAATAGCTTCGGCTCAAAGAGGGGGACCTTCGGGCCTCTCGCGTCAGGATATGCCCAGGTGGGATTAGCTAGTTGGTGAGGTAAGGGCTCACCAAGGCGACGATCCCTAGCTGGTCTGAGAGGATGATCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCAGTGAGGAAGGTGGTGATGTTAATAGCATCATCATTTGACGTTAGCTGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCCG

71. BLAST BLAST: Basic Local Alignment Search Tool
an unknown sequence can be matched up to known sequences published in GenBank
Lists all sequences producing significant alignments
Gene identification
Organism genus/species
% identity alignment/match

72. BLAST Results of BWET.PL4.8F

73. BLAST Results of BWET.PL4.8F
Summary of best match:
Vibrio sp. BISLTS1 16S ribosomal RNA gene
Identities = 435/436 (99%)
Vibrio is a genus of gram-negative bacteria. Typically found in salt water and are facultative anaerobes
Several spp cause human disease such as gastroenteritis and septicemia. Been known to cause fatal
infections in humans and marine life.

74. The End