Presentation is loading. Please wait.

Presentation is loading. Please wait.

Introduction to BLAST David Fristrom Bibliographer/Librarian

Similar presentations


Presentation on theme: "Introduction to BLAST David Fristrom Bibliographer/Librarian"— Presentation transcript:

1 Introduction to BLAST David Fristrom Bibliographer/Librarian
Give some suggestions on getting more meaningful results from BLAST searches David Fristrom Bibliographer/Librarian Science and Engineering Library

2 What is BLAST? Free, online service from National Center for Biotechnology Information (NCBI)

3 BLAST : Google : Internet What is BLAST? as
Nucleotide/Protein Sequence Databases as Google : Internet

4 Some Uses for BLAST Identify an unknown sequence
Build a homology tree for a protein Get clues about protein structure by finding similar proteins with known structures Map a sequence in a genome Etc., etc. Ask audience why they use BLAST

5 Basic Local Alignment Search Tool
What is BLAST? Basic Local Alignment Search Tool

6 Alignment AACGTTTCCAGTCCAAATAGCTAGGC ===--=== =-===-==-======
===--=== =-===-==-====== AACCGTTC TACAATTACCTAGGC Hits(+1): 18 Misses (-2): 5 Gaps (existence -2, extension -1): 1 Length: 3 Score = 18 * * (-2) – 2 – 2 = 6 Find best fit between two sequences, score for similarity. Assign scores based on matches and mismatches, and gaps. Similarity can be clue to homology, but they are not the same.

7 Global Alignment Compares total length of two sequences
Needleman, S.B. and Wunsch, C.D. A general method applicable to the search for similarities in the amino acid sequence of two proteins. J Mol Biol. 48(3):443-53(1970).

8 Local Alignment Compares segments of sequences
Finds cases when one sequence is a part of another sequence, or they only match in parts. Smith, T.F. and Waterman, M.S. Identification of common molecular subsequences. J Mol Biol. 147(1):195-7 (1981)

9 Search Tool By aligning query sequence against all sequences in a database, alignment can be used to search database for similar sequences But alignment algorithms are slow

10 What is BLAST? Quick, heuristic alignment algorithm
Divides query sequence into short words, and initially only looks for (exact) matches of these words, then tries extending alignment. Much faster, but can miss some alignments Altschul, S.F. et al. Basic local alignment search tool. J Mol Biol. 215(3):403-10(1990).

11 What is BLAST? BLAST is not Google
BLAST is like doing an experiment: to get good, meaningful results, you need to optimize the experimental conditions

12 Sample Search Human beta globin (HBB) Acquisition number: NP_000509
Subunit of hemoglobin Acquisition number: NP_000509 Limit to mouse to more easily show differences between searches

13 Interpreting Results Score: Normalized score of alignment (substitution matrix and gap penalty). Can be compared across searches Max score: Score of single best aligned sequence Total score: Sum of scores of all aligned sequences

14 Interpreting Results Query coverage: What percent of query sequence is aligned E Value: Number of matches with same score expected by chance. For low values, equal to p, the probability of a random alignment Typically, E < .05 is required to be considered significant

15 Getting the most out of BLAST
What kind of BLAST? Pick an appropriate database Pick the right algorithm Choose parameters

16 Step 0: Do you need to use BLAST?

17 Step 1: Nucleotide BLAST vs. protein BLAST
Largely determined by your query sequence BUT If your nucleotide sequence can be translated to a peptide sequence, you probably want to do it (use tool such as ExPASy Translate Tool) Protein blasts are more sensitive and biologically significant Sometimes it makes sense to use other blasts Show BLAST homepage. Talk about substitution matrix.

18 Specialized Search: blastx
Search protein database using a translated nucleotide query Use to find homologous proteins to a nucleotide coding region Translates the query sequence in all six reading frames  Often the first analysis performed with a newly determined nucleotide sequence

19 Specialized Search: tblastn
Search translated nucleotide database using a protein query Does six-frame translations of the nucleotide database Find homologous protein coding regions in unannotated nucleotide sequences such as expressed sequence tags (ESTs) and draft genome records (HTG)

20 Specialized Search: tblastx
Search translated nucleotide database using a translated nucleotide query Both translations use all six frames Useful in identifying potential proteins encoded by single pass read ESTs Good tool for identifying novel genes Computationally intensive  

21 Even More Specialized Make specific primers with Primer-BLAST
Search trace archives Find conserved domains in your sequence (cds) Find sequences with similar conserved domain architecture (cdart) Search sequences that have gene expression profiles (GEO) Search immunoglobulins (IgBLAST) Search for SNPs (snp) Screen sequence for vector contamination (vecscreen) Align two (or more) sequences using BLAST (bl2seq) Search protein or nucleotide targets in PubChem BioAssay Search SRA transcript libraries Constraint Based Protein Multiple Alignment Tool

22 Step 2: Choose a Database
Too large: Takes longer Too many results More random, meaningless matches Too small or wrong one: Miss significant matches

23 Protein Databases Non-redundant protein sequences (nr)
Kitchen-sink: Translations of GenBank coding sequences (CDS) RefSeq Proteins PDB (RCSB Protein Data Bank - 3d-structure) SwissProt Protein Information Resource (PIR) Protein Research Foundation (Japanese DB) Reference proteins (refseq_protein) NCBI Reference Sequences: Comprehensive, integrated, non-redundant, well-annotated set of sequences Swissprot protein sequences (swissprot) Swiss-Prot: European protein database (no incremental updates)

24 Protein Databases Patented protein sequences (pat)
Patented sequences Protein Data Bank proteins (pdb) Sequences from RCSB Protein Data Bank with experimentally determined structures Environmental samples (env_nr) Protein sequences from environmental samples (not associated with known organism)

25 Nucleotide Databases Human genomic + transcript
Mouse genomic + transcript Nucleotide collection (nr/nt) “nr” stands for “non-redundant,” but it isn’t GenBank (NCBI) EMBL (European Nucleotide Sequence Database) DDBJ (DNA Databank of Japan) PDB (RCSB Protein Data Bank - 3d-structure) Kitchen sink but not HTGS0,1,2, EST, GSS, STS, PAT, WGS

26 Nucleotide Databases Reference mRNA sequences (refseq_rna)
Reference genomic sequences (refseq_genomic) NCBI Reference Sequences: Comprehensive, integrated, non-redundant, well-annotated set of sequences NCBI Genomes (chromosome) Complete genomes and chromosomes from Reference Sequences

27 Nucleotide Databases Expressed sequence tags (est)
Non-human, non-mouse ESTs (est_others) Genomic survey sequences (gss) Like EST, but genomic rather than cDNA (mRNA) random "single pass read" genome survey sequences. cosmid/BAC/YAC end sequences exon trapped genomic sequences Alu PCR sequences transposon-tagged sequences

28 Nucleotide Databases High throughput genomic sequences (HTGS)
Unfinished sequences (phase 1-2). Finished are already in nr/nt Patent sequences (pat) Patented genes Protein Data Bank (pdb) Sequences from RCSB Protein Data Bank with experimentally determined structures

29 Nucleotide Databases Human ALU repeat elements (alu_repeats)
Database of repetitive elements Sequence tagged sites (dbsts) Short sequences with known locations from GenBank, EMBL, DDBJ Whole-genome shotgun reads (wgs)

30 Nucleotide Databases Environmental samples (env_nt)
Nucleotide sequences from environmental samples (not associated with known organism)

31 Database Options Limit to (or exclude) an organism
Exclude Models (XM/XP)  Model reference sequences produced by NCBI's Genome Annotation project. These records represent the transcripts and proteins that are annotated on the NCBI Contigs … which may have been generated from incomplete data. Entrez Query Use Entrez query syntax to limit search

32 Step 3: Choose an Algorithm
How close a match are you looking for? Determines how similarities are “scored” Affects speed of search and chance of missing match Again, what is the goal of the search?

33 blastp Protein-protein BLAST Standard protein BLAST

34 PSI-BLAST Protein-protein BLAST Position-Specific Iterated BLAST
Finds more distantly related matches Iterates: Initial search results provide information on “allowed” mutations; subsequent searches use these to create custom substitution matrix

35 PHI-BLAST Protein-protein BLAST Pattern Hit Initiated BLAST
Variation of PSI-BLAST Specify a pattern that hits must match Use when you know protein family has a signature pattern: active site, structural domain, etc. Better chance of eliminating false positives Example: VKAHGKKV

36 megablast Nucleotide BLAST Finds highly similar sequences Very fast
Use to identify a nucleotide sequence

37 blastn Nucleotide BLAST Use to find less similar sequences

38 discontiguous megablast
Nucleotide BLAST Bioinformatics Mar;18(3): PatternHunter: faster and more sensitive homology search. Ma B, Tromp J, Li M. Even more dissimilar sequences Use to find diverged sequences (possible homologies) from different organisms

39 Step: 4 Algorithm Parameters
Fine-tune the algorithm Short Queries Expect threshold: The lower it is, the fewer false positives (but you might miss real hits)

40 Algorithm Parameters Scoring Matrix: PAM: Accepted Point Mutation
Empirically derived chance a substitution will be accepted, based on closely related proteins Higher PAM numbers correspond to greater evolutionary distance BLOSUM: Blacks Substitution Matrix Another empirically derived matrix, based on more distantly related proteins Lower BLOSUM numbers correspond to greater evolutionary distance Compositional adjustment changes matrix to take into account overall composition of sequence

41 Algorithm Parameters Filters and Masking
Can ignore low complexity regions in searching

42 Additional Sources Pevsner, Jonathan Bioinformatics and Functional Genomics, 2nd ed. (Wiley-Blackwell, 2009) BLAST help pages: Slides from class on similarity searching; lots of technical details on algorithms and similarity matrices:


Download ppt "Introduction to BLAST David Fristrom Bibliographer/Librarian"

Similar presentations


Ads by Google