1. Endy, MIT April 2005 1 Drew Endy endy@mit.edu http://mit.edu/endy/www/talks/  file here [.ppt] http://parts.mit.edu/  Registry of Standard Biological Parts April 11, 2005 MIT Policy Opportunities Related to the Engineering of Biology

2. Endy, MIT April 2005 2

3. 3

4. 4 Previous Page Sequence (BNL) Dunn & Studier, J. Mol. Bio. 166:477 (1983)

5. Endy, MIT April 2005 5 Wild-Type T7 Genes 2.8-3 ----------------2.8-----------------> acgcaaagggaggcgacatggcaggttacggcgctaaaggaatccgaaa <----------------3--------------

6. Endy, MIT April 2005 6 Wild-Type T7 Genes 2.8-3 ----------------2.8-----------------> acgcaaagggaggcgacatggcaggttacggcgctaaaggaatccgaaa <----------------3-------------- T7.1 Parts 28 & 29 acgcaaGgggagAcgacaCggcaggttacggcgctaaggatccggccgcaaagggaggcgacatggcaggttacggcgctaaa ----------------2.8-----------------> <---------------3----

7. Endy, MIT April 2005 7 A0 TR/ SRL ø OLA1A2 R0.3 BoxA 0.30.40.5R0.50.6A/B0.7 C R11 ø 1.1A ø 1.1B R1.11.11.2 ø 1.3 R1.31.3TE1.41.51.61.7 ø 1.5 ø 1.6 A2 NsiIPciIMfeISpeIBclI B

8. Endy, MIT April 2005 8 A0 63 TR/ SRL ø OL 35 A1 88 A2 316 R0.3 BoxA 0.3 370 0.4 183 0.5 158 R0.5 52 0.6A/B 355 0.7 110291 C R11 2708139 ø 1.1A ø 1.1B R1.11.1 148 1.2 27580 ø 1.3 R1.31.3 1099 TE 65 1.4 173 1.5 110 1.6 279 1.7 164 ø 1.5 35 ø 1.6 35 A2 210443 NsiIPciIMfeISpeIBclI

9. Endy, MIT April 2005 9

10. 10 D23L AvrII D24L EcoRI D26L BamHI D27L EagI D28L SacII D30L SalI D22L BstEII D22RD23RD24RD26RD27RD28RD30R ø2.5 32.8 ø3.8 3.53.8R3.8 D25L XmaI D25R 2.5 D29L PciI D29R 1.82 BglII 175209357234384644787530675 FspIAvrII D50L BsiWI D51L PvuI D53L SacII D54L BamHI D55L XmaI D57L HindIII D50RD51RD53RD54RD55RD57R ø9 10ATøTø12 D52L EcoRI D52R 9 D56L ApaI D56R 8 PacI 1611351038354647359123823 ø10 11 DraIRsrII XbaI BssHIIAatIIAvaIBspHIEciINsiI NdeI AseI D57L HindIII D59L EcoRI D58L PfoI D57R D58R 1213 PacI 2382624173 ø13 R13 D60L BsiWI D62L EagI D59RD60RD62R 16 D61L PvuI D61R 15 ApaLI 59122443520437 14 NciI ScaI BstBIAvaI D64L HindIII D65L BamHI D67L ApaI D68L EcoRI D69L BsiWI D71L SalI D63L SacII D63RD64RD65RD67RD68RD69RD71R ø17 18.5/18.718 E 19/19.2/19.319.5R18.5 D66L XmaI D66R 17.5 D70L PstI D70R 17 35166220427053460176135150 øOR SRR/TR 160 KasIBspDIFspI BglI BlpIDraIIIAcvIAciIKpnI

11. Endy, MIT April 2005 11 Section alpha Section beta (1  8,311 bp) (8,311  12,179 bp)

12. Endy, MIT April 2005 12 Wild-Type T7 (T7 + ) Refactor [1-12,179] :T7 +

13. Endy, MIT April 2005 13 Kuroda-Kawaguchi et al., Nature Genetics 29:279 (2001)

14. Endy, MIT April 2005 14 Nature & Change - Pre-existing - Immutable - Changing - Evolution Human & Engineer - Pre-existing - Immutable - Changing - Evolution - Rational design - New - Decoupled [e.g., disposable] Nature & Form - Pre-existing - Immutable

15. Endy, MIT April 2005 15 Carlson, Pace & Proliferation of Biological Technologies, Biosec. & Bioterror. 1(3):1 (2003)

16. Endy, MIT April 2005 16 Goto Parts Goto NCBI. Goto BH Goto Cinnagen

17. Endy, MIT April 2005 17 Standardization of Components –Predictable performance –Off-the-shelf –ME, 1800s Abstraction –Insulate relevant characteristics from overwhelming detail –Simple artifacts that can be used in combination –From Physics to EE, 1900s Decoupling Design & Fabrication –Rules insulating design process from details of fabrication –Enable parts, device, and system designers to work together –VLSI electronics, 1970s Enabling Biological Engineering

18. Endy, MIT April 2005 18 Biological Risk (1)Past and ongoing work -Breeding -Animal release -Recombinant DNA technology (2) Liberal democracy in context of living world

19. Endy, MIT April 2005 19 Risk Biological Risk: Background Technology Classes Relevant to Biological Risk (current relative capabilities) Manipulation Analysis Response Detection

20. Endy, MIT April 2005 20 Risk Biological Risk: Background Technology Classes Relevant to Biological Risk (current relative capabilities) Analysis Response Detection Manipulation

21. Endy, MIT April 2005 21 Biological Risk: Tactics as “Strategy” Maginot Line France, 1940 Ciprofloxacin Smallpox vaccine Anthrax vaccine SARS assay VHF therapy (under construction) Plague vaccine (under construction)

22. Endy, MIT April 2005 22 Risk Biological Risk: Background Technology Classes Relevant to Biological Risk (current relative capabilities) Analysis Response Detection Manipulation

23. Endy, MIT April 2005 23 Biological Risk: Future Strategy Risk Technology Classes Relevant to Future Biological Risk (needed capabilities) Detection Analysis Response Manipulation

24. Endy, MIT April 2005 24 Biological Risk: Suite of Solutions Number of Individuals Individual’s Intent honorable dishonorable Bin Laden Genetics, Inc. Disgruntled Researcher Garage Bio-Hacker Basic Researcher

25. Endy, MIT April 2005 25 Biological Risk: Hack the Living World?

26. Endy, MIT April 2005 26

27. Endy, MIT April 2005 27

28. Endy, MIT April 2005 28 From: XXXX Subject: Endy Letter Date: January 6, 2005 9:45:17 AM EST To: endy@mit.edu Dr. Endy, I am a sophomore at XXXXX High School in Connecticut and have recently taken an interest in Synthetic Biology.I am writing to ask for your help because i am having difficulty in obtaining information,and understanding some of the information i already have. Anything you can send my way would be greatly appreciated… …I will soon begin working on a proposal to create a BioBrick, any information you can send me on their creation would be excellent. -Sincerely, XXXX XXXX High School -Grade 10

29. Endy, MIT April 2005 29 A Constructive Society

30. Endy, MIT April 2005 30 A Constructive Society

31. Endy, MIT April 2005 31 UT SB Competition Team c/o Jeff Tabor

32. Endy, MIT April 2005 32 Photons PoPS Light  PoPS Receiver PoPS  Color Converter BBa_I15010 BBa_R0082 BBa_B0034 BBa_E0033 BBa_B0015 UT SB Competition Team c/o Jeff Tabor

33. Endy, MIT April 2005 33 Lens ripped off of overhead projector Casserole dish Pile of cells/agar Thermostable chassis UT SB Competition Team c/o Jeff Tabor

34. Endy, MIT April 2005 34 UT SB Competition Team c/o Jeff Tabor

35. Endy, MIT April 2005 35 2003 - MIT IAP (Blinkers) 2004 - MIT IAP (Polkadots) 2004 - BU, Caltech, MIT, Princeton, UT Austin (FSMs) 2005 - Intercollegiate Genetically Engineered Machine (iGEM) Competition Caltech Davidson Harvard MIT Toronto UCSF/SFSU UT Austin 2006 - Intercollegiate Genetically Engineering Machine (iGEM) Competition iGEM 2005, 2006, … Oklahoma Princeton Cambridge ETH Zurich Penn State UC Berkeley

36. Endy, MIT April 2005 36 Technology Opportunities –General Infrastructure Supporting the Engineering of Biology Built from early days with foresight –Detection, Analysis, Response Students running a bio-detector on the corner of Ames & Main Education Opportunities –Undergraduate Program in Biological Engineering –Code of Ethics & Standards of Practice for Biological Engineers Would likely need to be backstopped by a professional society(s) Policy Opportunities –Coherent (?!) organization of federal funding –Integration of research and policy –Broad societal acceptance of responsibility for manipulating genetic information –International transparency? –Transition from “threat specific” to “capabilities-based” strategy –Distribution of technology? Open or closed?

37. Endy, MIT April 2005 37 Acknowledgements I would like to acknowledge Adam Arkin, Frances Arnold, Ralph Baric, Roger Brent, Jehoshua Bruck, Carlos Bustamante, Barry Canton, Rob Carlson, Leon Chan, Austin Che, Jim Collins, Lynn Conway, Ron Davis, Mita Desai, John Doyle, Eric Eisenstadt, Michael Elowitz, Stephanie Forrest, Timothy Gardner, Seth Goldstein, Homme Hellinga, George Homsy, Joe Jacobsen, Tom Kalil, Jay Keasling, Heather Keller, Doug Kirkpatrick, Tom Knight, Sri Kosuri, Patrick Lincoln, John Mulligan, Richard Murray, Radhika Nagpal, Richard Newton, Carl Pabo, Randy Rettberg, Pamela Silver, Brad Smith, Christina Smolke, Gerry Sussman, Samantha Sutton, Claire Tomlin, Jeffrey Way, Chris Webb, Ron Weiss, Scot Wolfe, Aarne Vesilind, other members of the lab and the MIT Synthetic Biology Working Group, and the students and instructors of the 2003/4 MIT IAP Synthetic Biology Labs and the 2004 Synthetic Biology Competition for their direct contributions to the material presented here and to my current thinking about how to best engineer biology.