1. Reseach Training Presentation By Yanhong Zhao Department of Evolutionary Functional Genomics, Uppsala University, Sweden Supervisor: Prof. Ulf Lagercrantz

2. Department of Evolutionary Functional Genomics Patterns of genetic diversity, effects of the present and the past Genetics of climatic adaptation in trees Genetics of flowering time variation Evolution of plant genomes Evolution of gene expression

3. Sequence analysis of genes in the highly redundant SHI family of Arabidopsis thaliana Functional Redundancy invoked when a gene is knocked out, which gives no discernable mutant phenotype, especially when a related duplicate gene exists STY1, STY2, SHI, SRS4, in the SHI gene family in Arabidopsis thaliana regulates gynoecium development, and shows a remarkable functional conservation, although they are highly divergent in sequences except in two conserved region

4. Purpose To characterise the evolutionary forces that act on the highly redundant SHI genes I will perform analysis of sequence divergence between SHI paralogs, and of patterns of within-species variation in A. thaliana

5. Materials Materials: Leaf samples of Arabiopsis thaliana are collected from 16 individuals which originally belong to 8 populations from Scandinavia (Norway and Sweden) and Italy

6. Methods PCR of STY1, STY2, SHI, SRS4 genes from 16 individuals Clean the PCR production MegaBASE sequencing to get the sequence Data Analysis using PHRED and PHRAP,DnaSP program, Mega3.1 and so on

7. Method 1:ExoSAP

8. Method 2:MegaBACE sequencing Principle: A sequencing reagent premix is combined with template DNA and primer and thermally cycled (Thermo Sequenase™ II DNA polymerase ) Result: Samples are finally dissolved in an appropriate loading solution for separation and detection Big difference from normal PCR: only one primer; without the step 95°C 2min for the unfoldment of templates

9. Result 1: Sliding window plots of Ka/ Ks for pairwise comparisons between STY1 and SHI in A.thaliana (DnaSP program)

10. Sliding window plots of Ka/ Ks for pairwise comparisons between STY2 and SRS4 in A.thaliana

11. Ka/Ks Ks = average distance between genes at synonymous sites; Ka = average distance between genes at nonsynonymous sites The average ratio was 0.134 and 0.198 for STY1- SHI and STY2-SRS4, respectively indicating mainly purifying selection (ratio less then one). A Ka/Ks ratio above one is indicative of positive selection. These regions could potentially be involved in diverged function of the paralogous genes.

12. Result 2:polymorphism table for STY2 (9 sequences) EEIIIIIIEE XXNNNNNNXX PPPPPPPPPPPPP1111111122 1111111122 222345667884555557802 45345754333118133335568 49444905081464501377644 Sty2_Bol1AGCTGAACAAACCACTTTTAGCG Sty2_Bol21.......C..A...C.......- Sty2_Tos99....T..CC.GGG.C.A...... STY2_TOS30....T..G..A.G.CAAAA.... Sty2_Ale41..A.T..C.CA..TC........ Sty2_Bel1....T..C..A...C........ Sty2_Mel19..A.T.GG..A..TC.....C.. Sty2_Ale77..A.T..G..A..TC........ Sty_Bel15GC.GTC.C..A...G....CCAT

13. Summary of Nucleotide Diversity GeneN (seq uenc es) Len gth( bp) Sπsπsy n πno nsyn θwTajima’ s D Statisti c STY29236 0 230.00 384 0.00 109 0.00 099 0.00 365 - 1.0417 8(NS)

14. S: Number of polymorphic (segregating) sites πs =estimated pairwise silent-site diversity πsyn= estimated pairwise synonymous-site diversity πnonsyn =estimated pairwise nonsynonymous-site diversity θw =estimated nucleotide diversity based on number of segregating sites NS = not significant

15. Nucleotide diversity is therefore reduced Estimate of silent-site (synonymous and non-coding) nucleotide diversity for STY2 is 0.00384. It is lower than the mean nucleotide diversity of 0.0074 reported for other A.thaliana genes (Yoshida et al. 2003). Nucleotide diversity is therefore reduced for that gene. One explanation for this reduction is positive selection for an advantageous haplotype although none of the neutrality tests (Tajima’sD, Fay and Wu’s H and MacDonald Kreitman) were significant

16. Conclusion mainly purifying selection for STY1-SHI and STY2-SRS4 The average ratio was 0.134 and 0.198 for STY1-SHI and STY2- SRS4, respectively indicating mainly purifying selection although they have one or two peaks which is indicative of positive selection Nucleotide diversity is therefore reduced for that gene Estimate of silent-site (synonymous and non-coding) nucleotide diversity for STY2 is 0.00384. It is lower than the mean nucleotide diversity of 0.0074 reported for other A.thaliana genes (Yoshida et al. 2003). Nucleotide diversity is therefore reduced for that gene. One explanation for this reduction is positive selection for an advantageous haplotype although none of the neutrality tests (Tajima’sD, Fay and Wu’s H and MacDonald Kreitman) were significant

17. Thanks!

18. McDonald and Kreitman test Type of changeFixedPolymorphic Non-synonymous183 Synonymous101

19. McDonald and Kreitman test Principle : If polymorphism within species and divergence between species are both the result of neutral mutations, the ratio of synonymous to replacement (non-synonymous) within species should be the same as the ratio between species. Result: no significant difference in the ratio of synonymous to replacement substitutions was found between fixed and polymorphic site, so we can not reject neutral evolution. However, the limited polymorphism and small sample of genes results in a low power of this test.

20. Estimate of silent-site (synonymous and non-coding) nucleotide diversity for STY2 is 0.00384. It is lower than the mean nucleotide diversity of 0.0074 reported for other A.thaliana genes (Yoshida et al. 2003). Nucleotide diversity is therefore reduced for that gene. One explanation for this reduction is positive selection for an advantageous haplotype although none of the neutrality tests (Tajima’sD, Fay and Wu’s H and MacDonald Kreitman) were significant

21. This is a polymorphism table for STY2. The nucleotide position and region of each polymorphism are indicated (P=promoter, EX=exon, and IN=intron). A dot represent an equivalent base relative to the reference sequence. A minus means a gap.