Presentation is loading. Please wait.

Presentation is loading. Please wait.

Introduction to Molecular Biology. G-C and A-T pairing.

Similar presentations


Presentation on theme: "Introduction to Molecular Biology. G-C and A-T pairing."— Presentation transcript:

1 Introduction to Molecular Biology

2

3

4 G-C and A-T pairing.

5 A & G = Purines C & T = Pyrimidines

6

7 Important terms: Nucleotide Pair = Base pair (bp) 1000 base pairs = 1 kilobase pairs (kb) 1,000,000 base pairs = 1 megabase pairs (Mb) 1,000,000,000 base pairs = Gb?

8 Double-stranded DNA is peeled apart to replicate DNA

9 The 2 daughter molecules are identical to each other and exact duplicates of the original (assuming error- free replication).

10 One chromosome is one long, twisted, dramatically compacted DNA molecule. The average length of a human chromosome is 130 million b.p.

11 Genes are defined segments of DNA

12 The information content of the DNA molecule consists of the order of bases (A, C, G, and T) along the length of the molecule.

13 Nucleic Acids DNA vs. RNA

14 RNA is quite similar to DNA, but usually single- stranded. Both are nucleic acids

15 In RNA, “U” replaces “T “

16

17 Important Concepts DNA and RNA have polarity- each strand has a 5’ and a 3’ end. (The 2 strands of DNA are anti-parallel) The common convention is to list only one strand of DNA, in a 5’ to 3’ direction: 5’ AGTCGTAGTCGTAGTCGTAGTCTG3’ (3’TCAGCATCAGCATCAGCATCAGAC 5’)

18 How Genes are Expressed- the Central Dogma.

19 Transcription = RNA synthesis Translation = Protein synthesis

20 Eukaryotic transcription operates ‘gene by gene’.

21 One strand of DNA is copied (sense strand); the antisense strand is never transcribed.

22 Transcription produces an RNA ‘copy’ of a gene (DNA) animation

23 Important Term: Transcription = RNA synthesis Quiz question- how does sequence of mRNA compare to sequence of noncoding strand of DNA?

24 The mRNA are translated in the cytoplasm

25 Three consecutive bases in the mRNA form one codon No exceptions- the genetic code is a triplet code.

26 tRNA are the ‘bilingual’ molecules

27

28 The genetic code is the codon-amino acid conversion table

29

30

31 http://academy.d20.co.edu/kadets/lundbe rg/DNA_animations/protein.mov

32 The immediate product of translation is the primary protein structure

33 The primary sequence dictates the secondary and tertiary structure of the protein

34 Important Term: Translation = Protein synthesis

35 There are 2 basic types of genes: Protein-coding genes: (DNA  mRNA  protein) RNA-specifying genes: (DNA  tRNA)(DNA  rRNA) (DNA  small RNA)

36 Genetic information, stored in DNA, is conveyed as proteins

37 Protein sequences are also represented linearly. Each of the 20 amino acid is can be represented by a 3 letter code: Ser Tyr Met Glu His In bioinformatics, each of the 20 amino acid is commonly represented by a 1 letter code: MDETSGHLKPWECVGH.....

38 Genetic information, stored in DNA, is conveyed as proteins

39 In sickle-cell anemia, one nucleotide change is responsible for the one amino acid change.

40 Sickle-cell anemia is caused by one amino acid change.

41 A single base-pair mutation is often the cause of a human genetic disease.

42 How to find a gene?* One way is too search for an open reading frame (ORF). An ORF is a sequence of codons in DNA that starts with a Start codon, ends with a Stop codon, and has no other Stop codons inside. * = inexact science

43 Each strand has 3 possible ORFs. 5' 3’ atgcccaagctgaatagcgtagaggggttttcatcatttgagtaa 1 atg ccc aag ctg aat agc gta gag ggg ttt tca tca ttt gag taa M P K L N S V E G F S S F E * 2 tgc cca agc tga ata gcg tag agg ggt ttt cat cat ttg agt C P S * I A * R G F H H L S 3 gcc caa gct gaa tag cgt aga ggg gtt ttc atc att tga gta A Q A E * R R G V F I I * V

44 Eukaryotic Genomes Finding a gene is much more difficult in eukaryotic genomes than in prokaryotic genomes. WHY??

45 Prokaryotic (bacterial) genomes: Are much smaller than eukaryotic genomes E. coli = 4,639,221 bp, 4.6 Mb Human = ~~ 3,300 Mb Contain a small amount of noncoding DNA E. coli= ~ 11% Human = > 95%

46 Eukaryotic transcripts (mRNA) are processed and leave the nucleus

47

48 Exon = Genetic code Intron = Non-essential DNA ? ?

49

50 The mechanism of splicing is not well understood.

51

52 Alternate Splice sites generate various proteins isoforms (HGP estimate = 35%)

53 Variable mutation rate? Most mutations in introns and intergenic DNA are (apparently) harmless Consequently, intron and intergenic DNA sequences diverge much quicker than exons.

54 Bacteria cells are different: Prokaryotic cells- No splicing (i.e. – no split genes) Eukaryotic cells- Intronless genes are rare (avg. # of introns in HG is 3-7, highest # is 234); dystrophin gene is > 2.4 Mb.

55 How to confirm the identification of a gene? Possible answer- Identify the gene by identifying its promoter.

56 Promoters are DNA regions that control when genes are activated. Promoter  [ ]

57 Exons encode the information that determines what product will be produced. Promoters encode the information that determines when the protein will be produced.

58 Nucleotides of a particular gene are often numbered:

59 Demonstration of a consensus sequence. De

60 How to find a gene? Look for a substantial ORF and associated ‘features’.

61 Two nucleic acids, that are exact complements of each other will hybridize. Two nucleic acids that are mostly complementary (some mismatchs) will...... hybridize under the right conditions.

62 Recombinant DNA techniques? Many popular tools of recDNA rely on the principle of DNA hybridization. In large mixes of DNA molecules, complementary sequences will pair.

63 Hybridization ‘in silico’ Algorithms have been written that will compare two nucleic acid sequences. Two similar DNA sequences (they would hybridize in solution) are said ‘to match’ when software determines that they are of significant similarity.

64 Protein- Protein similarity searches? Many algorithms have been designed to compare strings of amino acids (single letter amino acid code) and find those of a defined degree of similarity.

65 Significance of sequence similarity DNA similarity suggests: Similar function Similar structure Evolutionary relationship

66 The End


Download ppt "Introduction to Molecular Biology. G-C and A-T pairing."

Similar presentations


Ads by Google