1. CBC Computing with Biology & Chemistry MSc Natural Computation Department of Computer Science Universiy of York

2. Module description To give a foundation in computational systems that are inspired by biological and chemical systems, or that are themselves bio-chemical systems,  or that include a bio-chemical part as an essential constituent. This goes from well-understood areas like DNA computing to less mature areas like reaction-diffusion computers, P-systems, H-systems … Unifying theme is their differences from conventional computational systems, both in the approach taken to the computation and to the physical substrate used for the computation.

3. Who is it aimed at? Basic computer science experience of algorithms and complexity will be assumed No biological/chemical background will be necessary – but we will cover some genetics and chemistry very quickly, so be prepared to read a lot!

4. Level of mathematics required Ability to follow formal definitions of machines But this is not essential for very much of the module Basic complexity theory Some statistics/probability

5. Content 1: DNA Computing Starting point is the use of biological macromolecules for computing How do we represent data? How do we manipulate it? Is it efficient? Image from http://www.blc.arizona.edu/Molecular_Graphics/DNA_Structure/DNA_Tutorial.HTML

6. CATATAGGCAATATCCGTAG V 1,left V 1,right V 2,left V 2,right E x,left =Vc 1,right E x,right = Vc 2,left V 1,left V 1,right Representing data structures Each node represented by a 20-mer strand Each possible edge represented by a complementary 20-mer

7. Content 2: Complex systems

8. GRN

9. Content 3: RD systems Complex chemical reactions don ’ t always behave as expected …

10. Chemical logic gates: 3 input OR gate Controlled inputs are xyz 1-input ( “ clock ” ) is required to get output in the 000 case (shown) Graph shows response to three patterns (000, 111 and 010). In the latter two cases, there is a single intensity peak in the output. Gradually increasing response is due to “ ageing ” of the system Much more complicated functions can be implemented …

11. Practical elements As yet, no lab work with DAN or chemical systems There will be seminars Discussions on topics from the module based around a specified piece of reading Other possibilities include Simulation of DNA systems Analysis of complex dynamic systems (GRNs) Use of P-system simulators

12. Assessment The assessment for the module is open The assessment will consist of some or all of the following: Demonstration of understanding of lecture material Selection and application of algorithms to given datasets Analysis of the output of specific algorithms Review of the literature on a particular topic.