Presentation is loading. Please wait.

Presentation is loading. Please wait.

PCR based Requiring sequence knowledge

Similar presentations


Presentation on theme: "PCR based Requiring sequence knowledge"— Presentation transcript:

1 PCR based Requiring sequence knowledge
Molecular markers PCR based Requiring sequence knowledge courtesy of Carol Ritland

2 PCR markers prior sequence knowledge
Microsatellites (SSR/STR/ STMS) SSCP ISSR T-RFLP

3 Microsatellite (SSR/STR/STMS)
Also known as Short Sequence Repeat/Simple Tandem Repeats/Sequence-Tagged Microsatellite Sites Repeats are 1 to 10 nucleotides bp long Mutation rate is higher than base rate (1X104 vs 1X108) Related to VNTR (minisatellites) PCR based Require extensive labour prior to finding useable markers Can be expensive to find these markers Co-dominant Litt, M. and Lutty, J. A. Am. J. Hum. Genet :

4 Allelic Variation at a Microsatellite Locus
GCCATGACACACACAGTAACGT Allele “A” Allele “B” GCCATGACACACACACACACACACAGTAACGT

5 Mechanisms of mutation (slipped-strand mispairing)
Step 1 Step 2 Step 3 Step 4 ca ca ca ca gt gt gt gt gt gt gt ca ca ca ca ca ca

6 Development of SSR Construction of DNA library
Restriction Enzyme digestion Ligation to plasmid Screening for various repeats (Southern blot) Sequencing positive clones Primers design to flank microsatellites Testing Primers for polymorphism (need segregating families preferably with known parents) Focal vs Non focal species

7 Step by Step…. Restriction Digestion Gel electrophoresis Alu I AGCT
Hae III GGCC Rsa I GTAC Isolate fragments Vector for cloning Ligase 200 to 500 bp Cloning and screen for positive clones

8 Step by Step cont’d CA positive clone Screen for repeats
Using CACACA(25) probe Screen for repeats CA or CAT or CATA 1X106 clones Primer design from clones that show repeats Sequence all positive clones usually 96 at a time

9 SSR primer design 50% contain repeats < 10 bp
20% contain repeats starting at one end of the sequence 20% to 30% contain repeats that may be usable Watch for complex repeats eg. Compound = GCGGCCATATAT(16)GCGATGATATAT(16)GCGAA Irregular = GCGGCCATATATCCATATAT(16)CCATATGCG Complex = GCGGCCATATATCCATAT(12)GCTGCT(10)GCG Ideally design primers 18 to 24 nucleotides Aim for PCR product sizes that are > 100bp to 400bp

10 Primer testing Require ideally >3 populations for testing
Ideally 6 individuals randomly sample per population 20% yield zero or poor amplicons 24% yield multiple or uninterruptible bands 18% monomorphic bands 38% usable microsatellite marker Squirrell et al Mol. Ecol. 12:

11 SSR gel  = female parental type = male parental type = size ladder
WRC paternity analysis A. Miscampbell

12 Issues with Microsatellites (SSR)
Highly variable and somatically stable marker Specific primers designed for target species (18-25 nt) Highly reproducible and yet evolve quickly (mutation rate is higher than normal rates) A co-dominant marker with high heritability Excellent for paternity/pedigree analysis Could be difficult to use between species (focal vs non focal species) Null alleles (lacking one of the allelic band for some heterozyote individuals within a population) test with family; excessive homozygotes, under estimate of diversity Stutter bands (due to Taq incomplete amplification) Subjectiveness when scoring (be consistent)

13 Scoring microsatellites
Require known ladder to run with samples Resolve 2 or more bases differences using polyacrylamide gel Use base size to score allelic differences Sample Locus A Locus A’ Locus B Locus B’ Cat A 202 204 353 355 Cat B 200 206 357 Cat C 351

14 Score SSR gel: Samples = 21 204 bp 200 bp 175 bp 145 bp 120 bp 1 2 3 4
175 bp    145 bp 120 bp 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 A1 A2 B1 B2 C! C2 D1 D2

15 Allelic variation and statistical analyses
Matala, A.P., Gray, A.K., Heifetz, J. and Gharrett, A.J. (2004) Envior. Biololy of Fishes 69: Population structure of Shortkaker Rockfish

16 Example of allelic variation in microsatellites
Microsatellite variation and genetic relationship among Rajasthani sheep: Relevance for conservation R Arora and S Bhatia


Download ppt "PCR based Requiring sequence knowledge"

Similar presentations


Ads by Google