Genomics and Inheritance

Genomics and Inheritance
Title slide Hello! Today we are going to learn about the human genome and how your genome makes you unique. We’ll lead you through an activity where you extract your own DNA from your saliva. We’ll also talk about how scientists are using genomics to inform us about inherited diseases and we’ll do an activity that’s modeled after this kind of research.

What is DNA? What is DNA? So What IS DNA? DNA is the most basic molecular building block of you! Your DNA dictates your physical appearance but it also plays a role in determining your susceptibility to disease and even your personality! As you know, YOU are a unique individual, and part of what makes you unique is your distinct variation of DNA.

What is DNA Day? What is DNA Day?
DNA Day commemorates two major events in the history of our understanding about DNA.

What is DNA Day? What is DNA Day? In April 1953, James Watson and Francis Crick determined the structure of DNA. April 1953 Drs. James Watson and Francis Crick determined the structure of DNA (double helix)

What is DNA Day? April 1953 April 2003
50 years later, in April 2003, the Human Genome Project determined the entire sequence of human DNA. Research scientists are using the knowledge and technology generated by this project to further understand how your DNA sequence can contribute to disease. April 1953 Drs. James Watson and Francis Crick determined the structure of DNA (double helix) April 2003 Human Genome Project determined the entire DNA sequence of a human (3 billion letters)

A Genome is an entire set of an organism’s DNA
23 pairs of chromosomes J Craig Venter Institute What is a genome? A genome is an entire set of an organism’s DNA. You’re probably familiar with seeing a set of chromosomes, which is how an organism’s genome is condensed and packaged. The human genome contains 23 pairs of chromosomes, i.e. 46 total. [DNA molecule adapted from wikimedia commons, author: MesserWoland] The Human Genome

23 pairs of chromosomes J Craig Venter Institute Mother (Maternal) Father (Paternal) What is a genome? A genome is an entire set of an organism’s DNA. You have pairs of chromosomes because you inherit one from your mother and one from your father. In total, 23 chromosomes from each parent. Does every organism have 46 chromosomes? No, some have many more, and some have just one (like bacteria, viruses). One from your mother, one from your father The Human Genome

J Craig Venter Institute What is a genome? A genome is an entire set of an organism’s DNA. Every cell in your body contains a copy of your genome. That means every cell in your body has a full set of chromosomes. That’s a lot of DNA. All the DNA in your body sums up to about half a pound. [cell picture adapted from wikimedia commons, author NIH, user Phrood] Cell The Human Genome

DNA holds instructions for the cell
DeoxyriboNucleic Acid (DNA) contains all the information necessary to make a complete organism DNA is composed of a combination of 4 nucleotides DNA holds instructions for the cell DNA is a long molecule composed of a combination of 4 nucleotides. DNA encodes instructions for the work a cell should be doing. It’s like a language for your cells, except the alphabet it uses only has 4 letters.

DeoxyriboNucleic Acid (DNA) contains all the information necessary to make a complete organism DNA is composed of a combination of 4 nucleotides A T C G DNA holds instructions for the cell The nucleotides are the four small molecules adenine, thymine, cytosine and guanine, abbreviated by A, T, C and G. Adenine Thymine Cytosine Guanine

DeoxyriboNucleic Acid (DNA) contains all the information necessary to make a complete organism Two DNA molecules DNA holds instructions for the cell The DNA in your cells is actually composed of two molecules of DNA held together by nucleotides pairing with each other. The two molecules are said to be complementary. The shape that they form when paired is a double helix [DNA molecule adapted from wikimedia commons, author: MesserWoland]

DeoxyriboNucleic Acid (DNA) contains all the information necessary to make a complete organism Two DNA molecules Base Pair DNA holds instructions for the cell DNA nucleotides pair up in a consistent way. Adenine always pairs with thymine and cytosine always pairs with guanine. A pair of nucleotides in a DNA double helix is called a base pair. A pairs with T C pairs with G Which is how DNA forms a double helix. Adenine Thymine Cytosine Guanine

“DNA sequence” is the order of nucleotides on a DNA molecule
DNA double helix DNA sequence is the order of nucleotides on a DNA molecule When we look at a double helix, we only need the sequence of one of the molecules. Why is this? Since nucleotide pairing follows strict rules, we can always figure out the sequence of the complementary DNA molecule.

DNA double helix If we unwind it and look at one strand… DNA sequence is the order of nucleotides on a DNA molecule If we unwind one of the molecules and write out its nucleotides in order, this is its DNA sequence.

DNA double helix If we unwind it and look at one strand… DNA sequence is the order of nucleotides on a DNA molecule If we unwind one of the molecules and write out its nucleotides in order, this is its DNA sequence. ACCATCGTGCATGTCTC we can see its sequence

The entire human genome comprises over 3 billion base pairs
The entire human genome comprises over 3 billion base pairs. Here’s just the beginning. CGCAAATTTGCCGGATTTCCTTTGCTGTTCCTGCATGTAGTTTAAACGAGATTGCCA GCACCGGGTATCATTCACCATTTTTCTTTTCGTTAACTTGCCGTCAGCCTTTTCTTTGA CCTCTTCTTTCTGTTCATGTGTATTTGCTGTCTCTTAGCCCAGACTTCCCGTGTCCTTT CCACCGGGCCTTTGAGAGGTCACAGGGTCTTGATGCTGTGGTCTTCATCTGCAGGT GTCTGACTTCCAGCAACTGCTGGCCTGTGCCAGGGTGCAAGCTGAGCACTGGAGTG GAGTTTTCCTGTGGAGAGGAGCCATGCCTAGAGTGGGATGGGCCATTGTTCATCTT CTGGCCCCTGTTGTCTGCATGTAACTTAATACCACAACCAGGCATAGGGGAAAGAT TGGAGGAAAGATGAGTGAGAGCATCAACTTCTCTCACAACCTAGGCCAGTAAGTA GTGCTTGTGCTCATCTCCTTGGCTGTGATACGTGGCCGGCCCTCGCTCCAGCAGCTG GACCCCTACCTGCCGTCTGCTGCCATCGGAGCCCAAAGCCGGGCTGTGACTGCTCA AGCCAGCCGGCTGGAGGGAGGGGCTCAGCAGGTCTGGCTTTGGCCCTGGGAGAG CAGGTGGAAGATCAGGCAGGCCATCGCTGCCACAGAACCCAGTGGATTGGCCTAG GTGGGATCTCTGAGCTCAACAAGCCCTCTCTGGGTGGTAGGTGCAGAGACGGGAG GGGCAGAGCCGCAGGCACAGCCAAGAGGGCTGAAGAAATGGTAGAACGGAGCAG CTGGTGATGTGTGGGCCCACCGGCCCCAGGCTCCTGTCTCCCCCCAGGTGTGTGGT GGCTCTGGATGCCAGGCATGCCCTTCCCCAGCATCAGGTCTCCAGAGCTGCAGAAG ACGACGGCCGACTTGGATCACACTCTTGTGAGTGTCCCCAGTGTTGCAGAGGTGAG A The entire human genome comprises over 3 billion base pairs. Here’s just the beginning. This is the sequence of the very beginning of chromosome 1.This is showing the first 954 nucleotides. If you tried to put the entire human sequence into a power point presentation, it would take about 6.3 million slides! ...And be a very boring presentation.

Some sections of the genome are genes
A gene is a segment of DNA that contains instructions for the cell to make a protein. A protein is a large molecule that does a specific task in the cell, like breaking down cell waste or importing nutrients. The human genome contains about 20,000 genes. [DNA molecule adapted from wikimedia commons, author: MesserWoland] rcsb.org Gene – DNA instructions to make a protein Protein – a large molecule that does work for the cell

The genome is like a cookbook for the cell
Nucleotides Letters One way to think about the role of the genome is like it’s a cookbook for the cell. The nucleotides are like letters, arranged in certain ways to make words.

Nucleotides Letters Gene Recipe A sequence of nucleotides composes a gene. One way to think about the role of the genome is like it’s a cookbook for the cell. Genes are like entire recipes for the cell to make.

Nucleotides Letters Gene Recipe A sequence of nucleotides composes a gene. One way to think about the role of the genome is like it’s a cookbook for the cell. The whole genome is the cookbook full of recipes for the cell. Having only four different types of nucleotides doesn’t seem like it would give you much variety, but think of how much the order matters in the letters in a book. If you kept all the same letters in a book, but scrambled them, would you have the same book at all? [chromosome picture adapted from wikimedia commons, author NIH, user Phrood] Gene Genome Cookbook Cell Billions of nucleotides are packaged into chromosomes. Wikimedia commons

Refresher: What are each of these?
So now that we’ve gone through a lot of genomics terms, let’s review a little bit. Can you tell me what each of these are? nia.nih.gov

Refresher: What are each of these?
Cell Chromosome Genes Genome What we have here is a diagram of a cell. It has a number of (pink) chromosomes in its nucleus. Some sections of chromosomes comprise genes. The entire set of chromosomes is the genome. The chromosomes are made of DNA, seen spooled out for detail. DNA is made up of nucleotides. Nucleotides DNA nia.nih.gov

Please PAUSE to complete the DNA extraction activity
ll Please PAUSE to complete the DNA extraction activity

DNA Isolation Method Step 1: Add your saliva to the tube
Step 2: Add 1-2 drops of soap to tube and mix well Step 3: Add a pinch of salt and mix well Step 4: Add several droppers full of ethanol and mix well Step 5: Spool your DNA with stick Now that we have this DNA, can you tell the difference between your dna and you’re partners.

No two genomes are the same
Individuals differ at about .1% of their nucleotides. Broad Institute Variant Variant - A position in the genome where individuals have different nucleotides No two people have the same genome. Humans are the same at 99.9% of their genome sequence—that similarity is what makes us all human—but that leaves .1% of nucleotides that vary between individuals. A variant is a position in the genome where individuals have differing nucleotides. For example, one individual may have an A at certain position in the genome, while two other individuals have a G and a T at that position. Remember, most positions in the genome are invariant. Only about .1% of the nucleotides in the genome vary between individuals.

Individuals differ at about .1% of their nucleotides. Variant - A position in the genome where individuals have different nucleotides .1% 3 million variants No two people have the same genome. The human genome contains 3 billion nucleotides, so .1% of that gives us 3 million nucleotides that are variants. 3 billion nucleotides

Individuals differ at about .1% of their nucleotides. Variant - A position in the genome where individuals have different nucleotides .1% 3 million variants …………………………….. 1 2 3 million A G C T No two people have the same genome. The number of different genomes possible with these variants is astronomical. For a rough estimate, think of having four choices at each of those 3 million variants. The number of different choices you could make is 4 times 4 times 4 and so on 3 million times, or 4^(3 million). This is a much larger number than the number of individuals that have ever existed. Therefore the chances of there being two identical human beings at random is effectively zero. (except for twins, next slides) (The number is more accurately something like (4^6million + 4^3million)/2, to account for the diploid genome and non-unique combinations. One could also reduce the number further by arguing that most variant positions are biallelic and not tetrallelic as assumed here. The number is still huge though; you get the picture.) 3 billion nucleotides 4 choices at 3 million places  43million unique genomes

Actually, some genomes are the same
Identical twins have the same genome. Actually, some genomes are the same So I told you that no two people have the same genome….but identical twins are an exception. Here are some photographs of multiple pairs of identical twins done for National Geographic. Can you pick up small differences between some of these pairs? What does this tell you about how much your genome determines appearance? Martin Schoeller for National Geographic

Normal zygotes vs. identical twins
Normal Zygote: A fertilized egg develops into one individual. Normal zygotes vs. identical twins: Normally, a zygote (a fertilized egg) will multiply and develop into one fetus. A zygote multiplies and develops. A single individual is produced. Adapted from

Normal zygotes vs. identical twins
Identical Twins: A fertilized egg splits into two identical zygotes early on. Normal zygotes vs. identical twins: Sometimes, for unknown reasons, a zygote will split into two independent zygotes. However, even though they’re now separate, they have identical genomes. The two identical zygotes each develop into two identical fetuses. A zygote splits into two independent zygotes. The zygotes develop into two individuals with identical genomes. Adapted from

Clones also have the same genome
Another case where individuals have identical genomes is with clones. Dolly the sheep was cloned in 1996.

How Dolly was cloned To clone an animal you need a body cell and an egg cell. Body cell How Dolly was cloned. To clone an organism you need an egg cell and the genome to clone. Here we’re using the genome from a body cell of sheep A, and an egg cell from sheep B. The egg cell has the ability to multiply and develop into a lamb if placed in a sheep uterus. But we want the lamb to have sheep A’s genome. Egg cell bbc.co.uk

How Dolly was cloned Replace the genome of the egg cell with that of the cell to be cloned. Body cell Extract genome How Dolly was cloned. We need to remove the genome from the egg cell and replace it with the genome from sheep A. Replace egg cell’s genome Egg cell Remove genome bbc.co.uk

How Dolly was cloned Place the dividing egg cell into the uterus of a foster mother. Place egg into foster mother Body cell Extract genome How Dolly was cloned. Now we can implant the egg into a foster mother and the resulting lamb is a clone of sheep A. This cloning process is actually very inefficient. Scientists tried about 300 times before succeeding with Dolly. Cloning is known for the moral concerns that surround it, but there are some positive potential applications as well. One exciting application of cloning may be cloning endangered species to re-populate them, or even cloning extinct species. Replace egg cell’s genome Clone of sheep A Egg cell Remove genome bbc.co.uk

Your list of variant nucleotides is your genotype
Example chromosome Variants T A G C .….. … . Your list of variant nucleotides is your genotype. Remember that variants are positions in the genome where individuals have different nucleotides. A good way to catalogue the unique genome of an individual is to list the nucleotides at variant positions. Since you have a full set of chromosomes from each parent, you need to list the variant nucleotides for both maternal and paternal versions of each chromosome. Maternal

Example chromosome Genotype Variants T A G C .….. … . G T T T T C A A C A A G Your list of variant nucleotides is your genotype. As a small example, this maternal chromosome has six shown variants. These would be listed in positional order as G,T,T,A,C,A Maternal M

Example chromosome Genotype Variants Variants T A G C .….. … . C A T G .….. … . G T T T T C A A C A A G Your list of variant nucleotides is your genotype. The paternal chromosome has some different nucleotides than the maternal. Its list is T,T,C,A,A,G. Maternal Paternal M P

Example chromosome Genotype Variants Variants T A G C .….. … . C A T G .….. … . G T T T T C A A C A A G Your list of variant nucleotides is your genotype. Taken together, the variant nucleotides on maternal and paternal copies is your genotype. Maternal Paternal M P Genotype – The variant nucleotides on both maternal and paternal chromosomes. Your full genotype is unique.

Genomic variants result in unique individuals
First of all, lets take a minute to look around us. Just in this room, we can see many examples of physical variation. A lot of these differences are due to the small DNA differences between individuals. A .1% difference in genomes seems to make a lot of changes doesn’t it? What if the differences between genomes are even greater than that?

Big genomic variations allow for many different forms of life
Morten Koldby Leila Jeffreys Joel Sartore Big variation in genomes allows for many different life forms. All forms of life use the same 4 nucleotides that we use- A,C,T,G. The tremendous amounts of variation in genome sequence make the many distinct forms of life possible. The closer living things’ genomes are to each other, the more similar those living things will be. How similar do you think your genome is to a cactus? What about a chimp? Jennifer Cottom A.R. Valentien Insects.org Reo Kometani & Shinji Matsui

Variations in the DNA of different individuals can cause changes in physical appearance or can even cause disease. Variations in the DNA of different individuals can manifest as visible differences in those individuals or even cause disease. An example of a disease caused by a variant is Sickle Cell Anemia.

Variants can result in big changes
The A variant at position 5,248,232 on chromosome 11 causes Sickle Cell Anemia. Sickle-shaped diseased red blood cell Normal red blood cell University of Michigan Variants can result in big changes. A variant at position 5,248,232 on chromosome 11 causes Sickle Cell Anemia. Sickle Cell Anemia is characterized by sickle shaped red blood cells, which are unable to properly flow through blood vessels, resulting in severe anemia

The A variant at position 5,248,232 on chromosome 11 causes Sickle Cell Anemia. Sickle-shaped diseased red blood cell Normal red blood cell University of Michigan Variants can result in big changes. Having a T at that position is the most common nucleotide and does not cause the disease. …CTC…

The A variant at position 5,248,232 on chromosome 11 causes Sickle Cell Anemia. University of Michigan Variants can result in big changes. However, an A at that position results in abnormally shaped Hemoglobin proteins. The abnormal hemoglobin proteins cause red blood cells to become sickled in shape. Note: (if you’re confused about which nucleotide is considered disease/normal) The normal variant is a T on the 5’-3’ strand in the reference genome and A is the disease variant. The gene itself makes mRNA that looks like the complementary strand. So in the mRNA, A is normal and T is the disease variant. …CTC… …CAC… Variant Normal Disease Normal red blood cell Sickle-shaped diseased red blood cell

Different genotypes result in different outcomes
Genotypes observed T A The different genotypes at the Sickle Cell Variant result in different biological outcomes. T and A are the only nucleotides observed at that position in humans. So all the possible genotypes at that position are TT (both maternal and paternal chromosome 11 have a T), AT (one chromosome has an A, one has a T) and AA (both have A).

Different genotypes result in different outcomes
Genotypes observed T A The different genotypes at the Sickle Cell Variant result in different biological outcomes. A person with TT genotype has normal red blood cells. A person with an AT genotype has some, though not all, sickle shaped red blood cell. This person won’t show many symptoms of the disease. A person an AA genotype has mostly sickle shaped red blood cells and is severely affected. Normal Mostly Normal Sickle Cell Anemia micro-scopic.tumblr.com microscopyu.com

The variant is correlated to the disease
Genotype Sickle Cell count The variant is correlated to the disease. The variant is said to be correlated to the disease (Sickle Cell Anemia) because the different genotypes clearly correspond to different disease states, or outcomes. Here, the disease state we’re looking at is the number of sickle shaped red blood cells. T A micro-scopic.tumblr.com microscopyu.com

Sickle Cell count If we sampled many people with TT, AT and AA genotypes and measured the average sickle cell count for each genotype group, we could build a plot like this. We can see that the AA genotype group has an average sickle cell count of 0, the AA group has a high average sickle cell count, and the AT group has an intermediate count. T A Genotype

Genotype Sickle Cell count steep slope = correlation If we fit a line to these points, the line will have a steep slope, which indicates that the variant is correlated to Sickle Cell Anemia. We already knew that this variant causes the disease, but what if we want to see if any other variants are correlated to Sickle Cell Anemia? T A

Other variants show no disease correlation
The Sickle Cell A/T variant is the only variant correlated to the disease. Any other variant will not be correlated. For example: C/A variant Chr11:119,553,795 Other variants show no disease correlation. A variant not involved in the disease will show no correlation. As it turns out, Sickle Cell Anemia has fairly simple genetic origins—it’s caused by only one variant. So, any other variant in the genome should show no correlation to the disease. For example, let’s look at a variant at a different place on chromosome 11--position 119,553,795.

The Sickle Cell A/T variant is the only variant correlated to the disease. Any other variant will not be correlated. For example: C/A variant Chr11:119,553,795 Genotype Sickle Cell count Other variants show no disease correlation. If we measured the average sickle cell counts in groups of people with the different genotypes for a non-correlated variant, we would find that it was the same across the groups. This indicates that this variant has no role in sickle cell anemia. C A

The Sickle Cell A/T variant is the only variant correlated to the disease. Any other variant will not be correlated. For example: C/A variant Chr11:119,553,795 C A Genotype Sickle Cell count Other variants show no disease correlation. If we fit a line through all three points for average sickle cell count, that line has a slope close to zero. no slope = no correlation

Plot genotype vs. disease state to find how correlated a variant is to the disease
Plot genotype versus disease state to find how correlated a variant is to the disease. In the case of Sickle Cell Anemia we already knew which variant was correlated and which wasn’t. But what if we don’t know which variant is causing a genetic disease and we want to find out? All we have to do is plot a variant’s genotypes against some measure for the disease. If a line fitted through the points has a strong slope, then the variant is correlated to the disease. If the line is flat, then the variant is not correlated. Not Correlated

Genome Wide Association Studies find variants correlated to a disease or trait
1. Pick a disease or trait to test 2. Find individuals with and without the disease/trait Genome Wide Association Studies find variants correlated to a disease or trait. They use the method we just discussed—plotting genotype versus disease state. To conduct a Genome Wide Association Study we need to follow a few steps: First we need a disease to test of course! To clarify, Genome Wide Association Studies often test diseases, but they can be used to test variants correlated to non-disease traits as well, such as eye color or skin pigment. The next step is to find a group of individuals with the disease or trait and a group without. Disease No Disease

Genome Wide Association Studies find variants correlated to a disease or trait
3. Get genotypes of the individuals T T C A A T C C A T C A A A Genome Wide Association Studies find variants correlated to a disease or trait. 3. We need the genotype of each individual at each variant we’re testing. Genome Wide association studies often test thousands of variants and use hundreds of individuals. 4. Finally, for each variant we need to plot genotypes versus disease/trait state. The disease/trait state can be Yes/No (has the disease/doesn’t have the disease), or it could be something more continuous, like the count of sickle cells. 4. Test variants for their correlation to disease/trait A T Genotype Disease C A Genotype Disease or

Most traits are controlled by more than one variant
Sturm, R.A. Hum Mol Gen Most traits are controlled by more than one variant. So far, we only looked at the disease trait Sickle Cell Anemia, which is caused by one variant. However, most genetic traits, including diseases, are controlled by more than one variant. For example, take your skin color. There is no single variant that controls your particular skin tone; it’s determined by 12 different variants (that we know of). There are about 531,441* different genotype combinations you could have with these variants. That’s a lot of different skin tones. In general, the more variants that control a trait, the more possible variations of that trait. *calculated assuming that all 12 positions are biallelic and not in linkage with each other, 3^12, or 531,441. Skin color is determined by 12 different variants. 531,441 different combinations of these variants!

ll Please PAUSE to complete the activity

Every cell in your body has the same genome, except…
If some cells in your body carry a different genome, you are a mosaic or a chimera. Every cell in your body has the same genome, except… Every cell in your body contains a copy of your genome, though there are cases where some of your cells have a slightly different genome. A mosaic or chimera has cells in their body that carry different genomes from the majority of their cells. The cells with different genomes could be randomly scattered throughout the body or concentrated in certain areas. Recent research has shown that mosaicism and chimerism are much more common in humans than previously believed Nature Review Genetics

If some cells in your body carry a different genome, you are a mosaic or a chimera. One zygote Mutation Fusion or exchange of cells Mosaic Chimera Two zygotes Every cell in your body has the same genome, except… Mosaicism occurs when one of your cells randomly undergoes a mutation in its genome. Here it is shown happening during fetal development, but it could theoretically happen at any time. There’s a good chance that many people in this room are mosaics. © Garland Science

If some cells in your body carry a different genome, you are a mosaic or a chimera. One zygote Mutation Fusion or exchange of cells Mosaic Chimera Two zygotes Every cell in your body has the same genome, except… You’re a chimera when some of the cells in your body have genomes that come from a different person. This often happens when fraternal twins are conceived, but early in development the zygotes combine and only one individual is produced. This individual is a chimera, carrying some cells with one twin’s genome, and some with the other twin’s genome. © Garland Science

The first human genome was sequenced in 2001
Ben Moore, wikipedia.org The first human genome was sequenced in 2001. Research on the human genome, including Genome Wide Association Studies and studies on chimerism and mosaicism, has been made possible by genome sequencing. Sequencing of the first human genome was sequenced (drafted) in 2001 after about ten years of work and 2.7 billion dollars. Since then, the cost of sequencing has dropped steeply. Now a human genome can be sequenced in a month for less than $10,000.

The 1000 Genomes Project The 1000 Genomes Project
There is a lot of exciting research going on right now to discover more about the human genome. Since every genome is very different, scientists recognized the need to sequence more than just one genome. The 1000 Genomes Project is an internationally led endeavor that has fully genotyped over 1000 individuals worldwide, with more to come. Gathering all this data is extremely helpful to the study of human biology. Our genomes determine so much about us: behavior, abilities, appearance, disease tendencies, etc. Studying genomic traits in different regions of the world can even tell us about human history—where groups migrated and how they spread and merged. medschool.wustl.edu

Genomics tells us about our ancestry
Thousands of years before present Genomics tells us about our history. Here, researchers built a tree based on genome analyses from populations around the world. Populations that are more closely related have branches that are closer together, and populations that are more distant show a split much earlier on. Think of the tree as a really long-spanning family tree. This tree shows a founding population at the bottom, which branches into African and non-African population about 150,000 years ago. This illustrates the Out of Africa Model, the idea that humans originated in Africa, then later a group migrated out and eventually colonized the rest of the world. Another group stayed behind, eventually becoming the branches on the left—modern African populations. Klyosov and Rozhanskii, 2012

Genomics created the field of “personalized medicine”
Medical treatments may one day be customized to your genome. Genomics created the field of personalized medicine. Disease development and response to drugs vary greatly from individual to individual. This is because everyone has a different genome that creates a unique cellular environment that interacts with treatments in a unique way. A future goal of medicine is to customize treatments to each patient’s genome.

About the Scientist: What do I study? Why do I love science?
Questions?

Genomics and Inheritance

Similar presentations

Presentation on theme: "Genomics and Inheritance"— Presentation transcript:

Similar presentations

About project

Feedback

Log in

Auth with social network:

Genomics and Inheritance

Similar presentations

Presentation on theme: "Genomics and Inheritance"— Presentation transcript:

Similar presentations

About project

Feedback