1. Introduce to Microarray

2. Copyright notice
Many of the images in this power point presentation of other people. The Copyright belong to the original authors. Thanks!

3. Evolution & Industrialization
1989: First Affymetrix Genechip Prototype
1994: First Commercial Affymetrix Genechip
1994- First cDNAs arrays were developed at Stanford University.
1994: First Commercial Scanner-Affymetrix
1996- Commercialization of arrays
1997-Genome-wide Expression Monitoring in S. cerevisiae

4. Why use DNA Microarrays for Expression Analysis?
Conventional expression analysis only allows the study of the expression of a single gene in a single experiment
The highly parallel nature of microarrays allows the simultaneous study of the expression of thousands or even tens of thousands of different genes in a single experiment
Microarrays allow researchers to undertake global expression analysis that is not feasible with conventional techniques

5. What Microarrays detect?
What genes are Present/Absent in a cell?
What genes are Present/Absent in the experiment vs. control?
Which genes have increased/decreased expression in experiment vs. control?
Which genes have biological significance?

6. Why analyze so many genes?
Just because we sequenced a genome doesn’t mean we know anything about the genes. Thousands of genes remain without an assigned function.
Patterns/clusters of expression are more predictive than looking at one or two prognostic markers – can figure out new pathways

8. The 6 steps of a DNA microarray experiment
Manufacturing of the microarray
2. Experimental design and choice of reference: what to compare to what?
3. Target preparation (labeling) and hybridization

9. The 6 steps of a microarray experiment (cont.)
4. Image acquisition (scanning) and quantification (signal intensity to numbers)
5. Database building, filtering and normalization
6. Statistical analysis and data mining

10. Different Types of DNA Microarrays
How DNA sequences are laid down
Spotting
Photolithography (Affymetrix)
type of DNA sequences
cDNA (Complete sequences)
Oligonucleotides

11. Affymetrix Microarrays
Involves Fluorescently tagged cRNA
One chip per sample
One for control
One for each experiment
Spotted Microarrays
Involves two dyes/one chip
Red dye
Green dye
Control and experiment on same chip

12. Production of Affymetrix Arrays
Choice of probes
25mer oligonucleotides
11-16 per gene
3’ biased
Dispersed
Chosen to minimize cross-hybridization
Computer algorithms are used to design photolithographic masks for use in manufacturing

13. Each gene is represented on the probe array by multiple probe pairs
Each probe pair consists of a perfect match and a mismatch oligonucleotide

14. Match and mismatch ATGCTGTACAATCGCTTGATACTGG ATGCTGTACAATAGCTTGATACTGG
The exact match is a section of the mRNA sequence you wish to probe for
The mismatch is identical except for one base difference from it’s exact match counterpart, and is used to calculate a background.
There are typically 11 “probe pairs” scattered around the chip- called a probe set.
By combining the expression values for a probe set, a value for the expression of mRNA can be found.
ATGCTGTACAATCGCTTGATACTGG
ATGCTGTACAATAGCTTGATACTGG
Mismatch probe:
Target sequence:
Perfect match probe:

15. Why do we have mismatch probes?
Mismatch probes (MM) are trying to detect background.
The mismatch probes are supposed to detect things that are close but not an exact match.
It is assumed that these things also bind to the perfect match (PM), erroneously.

16. Production of Affymetrix Arrays: Photolithographic Synthesis

17. Creating Targets mRNA cDNA cRNA Target Reverse Transcriptase
in vitro transcription
cRNA

18. RNA-DNA Hybridization
Targets
RNA
probe sets
DNA
(25 base oligonucleotides of known sequence)

19. Non-Hybridized Targets are Washed Away
(fluorescently tagged)
“probe sets” (oligo’s)
Non-bound ones are washed away

20. Custom GeneChips
Affymetrix offers over 120 prokaryotic arrays that are manufactured by Nimblegen Inc.
Custom GeneChips are also available for both Eukaryotic and Prokaryotic systems.

21. Spotted Arrays Robotically spotted cDNAs or Oligonucleotides
Printed on Nylon, Plastic or Glass surface
DNA probes prepared in 384-well plates
Glass slides bought commercially or prepared in house
Arrays are spotted with a commercial arrayer
Replicates
Controls

22. Microarray of thousands of genes on a glass slide

23. Spotted arrays steel spotting pin chemically modified slides
384 well source plate
chemically modified slides
1 nanolitre spots
um diameter

24. bacterial glycerol stocks)
Building the chip
PCR amplification
Directly from colonies with
SP6-T7 primers in 96-well
plates
Consolidate into
384-well plates
Arrayed Library
(96 or 384-well plates of
bacterial glycerol stocks)
Slide 4
Ideally, you will have a slides consist of all genes in the genomeThe design of the array / template is an imporatnt bioinformatics question. As you are only able to detect expression of genes on this template.
Spot as microarray
on glass slides

25. Expression profiling with DNA microarrays
cDNA “B”
Cy3 labeled
cDNA “A”
Cy5 labeled
Laser Laser 2
Hybridization
Scanning
Slide 5
You will have another sample of interests consists of a portion of the genes and the questions is to find out what genes are being expressed in this sample. The simplified version of the experiments is to label the sample with a color dye hybridize the sample on the slides and scan the slides under some laser to see which spots that light up. This provides a list of genes and it’s corresponding expression levels in our samples.
Our interest is on comparing the expression levels between the two samples. +
Analysis
Image Capture

26. Spotted Arrays
Affymetrix Arrays
Homemade
Tailored
Cheaper?????
Maximum 24,000 features per array
Prone to variability
Commercially available
“Off the rack”
More expensive?????
Maximum 500,000 features per array
Less variability

27. Oligonucleotide
cDNA
Greatly reduced cross-hybridization
Uniform Tm
Requires knowledge of gene sequences
More expensive???
Cross-hybridization possible
Non-uniform Tm
No gene sequence knowledge required
Less expensive

28. Microarray Experiments Animation

29. Microarray Life Cycle Biological Question Data Analysis & Modelling
Sample Preparation
Microarray Life Cycle
MicroarrayDetection
Microarray Reaction

30. W.W.W resources Complete guide to “microarraying”
Parts and assembly instructions for printer and scanner;
Protocols for sample prep;
Software;
Forum, etc.
Animation: