1. A quick course in genetics part 1 by Elísabet Einarsdóttir Elisabet.Einarsdottir@medbio.umu.se 7. Nov 2003

2. Cells DNA, genes & chromosomes RNA & transcription Meiosis & mitosis Mendel Chromosome recombinations Genetic & physical distances Uses for genetics & genomes General outline

3. Cells DNA, genes & chromosomes RNA & transcription Meiosis & mitosis Mendel Chromosome recombinations Genetic & physical distances Uses for genetics & genomes

4. The basic structure of living organisms - the cell

5. More cells Plant cell Bacterial cell

6. Cells DNA, genes & chromosomes RNA & transcription Meiosis & mitosis Mendel Chromosome recombinations Genetic & physical distances Uses for genetics & genomes

7. Central dogma of information flow in genetics

8. DNA (dideoxynucleic acid) – the double helix

9. The structure of DNA

10. A gene A segment of DNA that is the template for making a protein

11. Structure of a gene regulatory region Region that acts as a template for the production of proteins

12. Chromosomes - the packing of DNA

13. Telomere regions The structure of a chromosome

14. p1 p2 p5 p3 p4 q3 q5 q4 q2 q1 q6 q7 p-arm of chromosome (short arm) q-arm of chromosome (long arm) Chromosome banding E.g. linkage of a disease to 2q7.2

15. The human chromosome map

16. Chromosomal abnormalities Turner syndrome – only one X chromosome Downs syndrome – 3 copies of chr 21

17. Cells DNA, genes & chromosomes RNA & transcription Meiosis & mitosis Mendel Chromosome recombinations Genetic & physical distances Uses for genetics & genomes

18. Extracting genetic information from DNA - making an RNA copy of DNA

19. DNA to RNA to protein via the ribosome

20. The splicing of RNA Ready-to-use mRNA Unspliced RNA copy of DNA DNA template exon intronexon intron

21. Alternative splicing of RNA Different functions of different splice variants Different expression of different splice variants Dominant-negative variants

22. Amino acids Amino acids link together to form a long chain R (side chain) – varies between amino acids There are 20 different amino acids

23. Ribosomes translate 3-base sequences into amino acid chains – the building blocks for proteins RNA “copy of DNA” AAGCUGAGAUCAGUUCGGAUACCGUA Note: T in DNA becomes U in RNA amino acid chain ribosome

24. In-frame: THE FAT CAT ATE THE BIG HAT 1 bp deletion: THF ATC ATA TET HEB IGH AT 1 bp added: THE FAT CCA TAT ETH EBI GHA T The importance of being in-frame

25. 3D structure of a protein

26. Cells DNA, genes & chromosomes RNA & transcription Meiosis & mitosis Mendel Chromosome recombinations Genetic & physical distances Uses for genetics & genomes

27. Mitosis - a cell divides to make two identical cells – part of normal growth

28. Meiosis – only during reproduction Egg cells from mother Sperm cell from father An offspring Half of the chr from mother, half from father

29. Cells DNA, genes & chromosomes RNA & transcription Meiosis & mitosis Mendel Chromosome recombinations Genetic & physical distances Uses for genetics & genomes

30. Loci, alleles & markers A locus is any point (or region) in the genome A genetic marker is anything in the genome that is variable and can be used to compare individuals If a locus is variable, distinct alleles (forms) of the locus (e.g. a gene or marker) can be defined and analyzed A genotype is the set of alleles an individual has at a particular locus A phenotype is a visible trait in an individual (e.g. blue eyes or the presence of a disease)

31. Gregor Mendel (1822-1884) - the austrian monk with a passion for peas The law of segregation Each individual carries two copies (alleles) of every gene and only one of these is transmitted to each child The law of independent assortment Alleles from unlinked loci are assorted independently

32. Mendel´s experiment with peas Punnet´s square: ½ Ss = smooth ¼ SS = smooth ¼ ss = Wrinkled S: smooth gene s: mutated smooth gene

33. In each individual a trait is determined by two copies (alleles) of the same gene, one paternal and one maternal Only one of the two parental alleles is transmitted to each child but with equal probability 50% A50% a 50% A25%AA25%Aa 50% a25%Aa25%aa Mother Aa Father Aa Principles of Mendelian analysis -First law

34. Principles of Mendelian analysis - Second law -The principle of independent segregation applies independently to gene pairs determining different traits - Alleles from unlinked loci are assorted independently 50% A50% a 50% B25%AB25%aB 50% b25%Ab25%ab Aa Bb

35. Alleles from unlinked loci segregate independently

36. Alleles from linked loci do not segregate independently

37. A child always inherits one copy of each chromosome from each of the parents (meiosis, Mendel’s fist law) Any deviation from this can be pathogenic, e.g. Turner syndrome (only one X) and Downs syndrome (3 copies of chr 21) A girl has two X chromosomes (one from each parent), a boy one X and one Y chromosome (X from mother, Y from father) – implications for X-linked diseases Each chromosome is inherited independently of the other one, which copy of a parents chromosomes the child inherits is thus random (Mendel’s second law) Some points to note

38. Cells DNA, genes & chromosomes RNA & transcription Meiosis & mitosis Mendel Chromosome recombinations Genetic & physical distances Uses for genetics & genomes

39. Recombination of parental chromosomes - a source of variation & essential for looking at genetic distances & mapping disease

40. Recombination pattern in a family Parental grandparents Maternal grandparents FatherMother Child

41. Recombinations happen only during meiosis (during the generation of egg- or spermcells). Recombinations occur in each generation, usually at least once per chromosome Recombinations are in theory random, but in principle the likelyhood of recombinations at a particular point in the genome is quite variable Almost no recombination at the centrimere, higher frequency of recombinations closer to the telomeres Some points on recombinations

42. Cells DNA, genes & chromosomes RNA & transcription Meiosis & mitosis Mendel Chromosome recombinations Genetic & physical distances Uses for genetics & genomes

43. Physical distance - Mb The lowest-resolution physical map is the chromosomal map, based on the banding patterns observed by microscopy of stained chromosomes. More detailed radiation hybrid maps are made by breaking the chromosomes into small pieces. If two markers map to the same small fragment they are likely to be close together. The highest-resolution physical map is the complete sequencing of each chromosome in the genome Physical maps can be divided into three general types: chromosomal or cytogenetic maps, radiation hybrid maps, and sequence maps.

44. Physical maps at NCBI

45. Centimorgan (cM): a unit of chromosome length, equals the length of chromosome over which crossing-over occurs with 1 per cent frequency AB ab A b Recombination between locus A and locus B If 1% of meiosis result in recombinant chromosomes => 1cM between A and B Genetic distance - cM

46. Genetic maps at NCBI

47. Cells DNA, genes & chromosomes RNA & transcription Meiosis & mitosis Mendel Chromosome recombinations Genetic & physical distances Uses for genetics & genomes

48. Uses for genetics Mapping disease Genetic tests for known diseases Microbial genomics Forensics Paternity tests Development of medicines - pharmacogenomics Breeding of animals and plants Phylogenic studies & evolution

50. Human Genome Project Founding partners: U.S. Department of Energy National Institutes of Health (NIH) Wellcome Trust As well as groups in Japan, France, Germany, and China Aims: To generate a high-quality reference DNA sequence for the human genome‘s 3 billion base pairs and to identify all human genes. Also to sequence the genomes of model organisms to interpret human DNA, enhance computational resources to support future research and commercial applications, explore gene function through mouse-human comparisons, study human variation, and train future scientists in genomics.

51. The human genome consists of 3 billion bases (A, C, T, and G). The function of 50% of known genes is unknown. The human genome sequence is almost (99.9%) exactly the same in all people. A human genome is 97% like a chimp genome, 75% of the mouse genome Over 40% of the predicted human proteins share similarity with fruit-fly or worm proteins. Chromosome 1 (the largest human chromosome) has the most genes (2968), and the Y chromosome has the fewest (231). After the Human Genome Project

52. The future of genetics?

53. The human genome is like a book where each letter has been read, but there are no chapters or page numbers so you don’t really know what it all means or what to make of it....