1. ACCESSING AND EXTRACTING CHIP-SEQ AND TF-GENE INTERACTIONS FROM PAZAR
Jonathan Lim
With Introduction by Wyeth Wasserman

2. Welcome
If you encounter any technical difficulties during the webinar, type a report using the chat option
Slide presentation ~25 min
Compile Questions as they are submitted and answer them during the final Q&A/discussion period
During the discussion session, we’ll allow audience speaking

3. Topics PAZAR Overview Data Retrieval Through Web Interface
Data Files and Formats
PAZAR Application Programming Interface (API)
Q&A

4. 4 Topics will increase in complexity as webinar progresses
Data file formats will be presented in order of complexity, beginning with the simplest
PAZAR API will be the most technical topic presented today and is geared toward those with programming knowledge 4 4

5.
Software framework for the construction and maintenance of regulatory sequence data annotation
Allows multiple boutique databases to function independently within a larger system
Public repository for regulatory data
Each group manages its own deposit and distribution of data
Envisioned as tool for capturing deep experimental annotation
Species, cell line, treatment
PAZAR is an open access and open development project

6. Browsing Data on PAZAR
Link to project details

7. Project Information

8. Gene View
Link to sequence details

9. Sequence Information

10. TF View

11. Data File Formats

12. Data Files available for Download

13. TF – Target Gene Format
Provides listing of TFs and the genes that they putatively regulate
In some cases, the gene is the most proximal to the TF binding site - especially true for ChIP-Seq regulatory sequences.
PubMed ID and Analysis method provided as interaction evidence when available
Files automatically exported for all public projects
Updated weekly

15. TF – Target Gene File Example
PAZAR TF ID
TF Name
PAZAR Gene ID
Ensembl Gene Accession
Chromosome
Gene Start Coordinate
Gene End Coordinate
TF E2F4_HUMAN GS ENSG Homo sapiens E2F4_Lee PROTEIN BINDING ASSAY::CHROMATIN IMMUNOPRECIPITATION (CHIP)
Species
Project Name
Evidence PMID
Analysis Method

16. ChIP-Seq Peak Format
For users who are only interested in ChIP-Seq peak data
Provides peak information in a simple delimited format that is easy to work with
Files will be exported for public projects containing ChIP-Seq data and updated weekly

18. ChIP-Seq Peak File Example
chr MAXHEIGHT ENSG E2F4 Homo sapiens Human Lymphoblastoid cells
Peak start coordinate
Peak max coordinate
Chromosome
Peak end coordinate
Score
Score type
TF ID
TF Name
Species
PMID
Cell or Tissue

19. PAZAR GFF Format
GFF format describes genes and other features associated with DNA, RNA and Protein sequences
The PAZAR GFF format is intended to represent simple annotations
One annotation record per line, one annotation for one sequence
Not as comprehensive as XML files; represents a subset of total data, but may be easier for some people to work with
Projects containing only artificial sequences (eg. jaspar_core) follow slightly different format. Refer to GFF format documentation for details.
Files automatically exported for all public projects
Updated weekly

21. PAZAR GFF File Example
chr12 E2F4_Lee RS sequence="CA…AT";db_seqinfo="ENSEMBL:60_37E";db_geneinfo="ENSEM BL:ENSG :C12ORF26 ";species="HOMO SAPIENS"; db_tfinfo="EnsEMBL_transcript:ENST :E2F4_HUMAN";analysis _name="ANALYSIS 1";analysis_comment="0";cell_type="HUMAN LYMPHOBLASTOID (GM06990) CELLS :HOMO SAPIENS";pmid=" ";method="PROTEIN BINDING ASSAY::CHROMATIN IMMUNOPRECIPITATION (CHIP)";evidence="CURATED"
Sequence start coordinate
Sequence end coordinate
Chromosome
Project Name
PAZAR Feature ID
Strand
Score
Frame
Mandatory Attributes
Optional Attributes

22. PAZAR XML Format
Extensible Markup Language (XML) is a markup language that defines a set of rules for encoding documents
PAZAR XML schema defined for capturing data and relationships
Comprehensive and flexible enough to capture many types of data
Files automatically exported for all public projects
Updated weekly

24. Sample PAZAR XML File
<reg_seq
pazar_id="rs_0022"
quality="TESTED"
sequence="CGGGCTCTCCGACCCACGGGTCACTTTTGACAGCTGGCCTGAGTCCTGCCTGGTGGAAACCCCTCCTGGGAGGCTGGAGCCAGCACCAGGGCCCACGTGTGCTT
CACCTTGAAGCCTGAGGACACAGACTCTCCGGCAATCACATAGCCCATGTTGAGGACGCTGCCTTCAATGGAGCACGTGATCATGGACGCCACGCCAGTGCCCATGAGGGTGA
GGGTGAGCGTGCCTCTCTTGGTGATGATGTCCAG"
tfbs_name=""> ….
<peak
maxcoord=" "/>
</reg_seq>
<funct_tf
funct_tf_name=“E2F4_HUMAN"
pazar_id="fu_001">
<tf_unit
pazar_id="tu_0001"
tf_id="tf_001"/>
</funct_tf>
<interaction
pazar_id="in_00063"
quantitative="299.77"
scale="MAXHEIGHT"/>
Understanding of schema and parsing work required to extract ChIP-Seq data

25. PAZAR API Overview
Application Programming Interface (API) facilitates programmatic retrieval of data contained in 'Published' or 'Open' projects as well as user's own restricted projects.
Provides a mechanism for automating bulk data retrieval in a customized fashion
Provides Methods to make it easier to work with data once it has been retrieved
Object – oriented -> data types within the system can be mirrored as objects in code
Uses the perl programming language
Uses SOAP communication protocol for transferring data

26. SOAP
Simple Object Access Protocol (SOAP) is a protocol for exchanging structured information between networked computers. It relies on Extensible Markup Language (XML) for its message format.
Communication done using http as transport layer, can be used on any network that permits web browsing
Client computer sends requests to server, which performs functions to retrieve data from database and return it to client
Code to perform functions resides on the server, so client only needs to send requests in order to receive data
Simple Object Access Protocol (SOAP) is a protocol for exchanging structured information between networked computers. It relies on Extensible Markup Language (XML) for its message format.
- Communication done over http, can be used on any network that permits web browsing

27. Benefits of using SOAP
Users do not have to worry about installing the API code on their computer
Updates to newer API releases involve minimal effort
Can be used across firewalls where only web browsing is permitted
Transparent – users don't have to learn new syntax or change the way they code
Language independent, but yet to be further developed and tested with programming languages other than perl in mind
Data privacy can be managed by the PAZAR team since authentication is done on the server side

28. Data Privacy
Access to data through API same as through website. PAZAR username and password must be supplied to retrieve data from personal restricted projects.
Authentication is performed on PAZAR server
Request Parameters
Access To Restricted Data
Access To Public Data
Correct user/password
and user is a member of specified project
Results from specific restricted project being queried
Results from all public projects
Incorrect username / password combination
or invalid project name
or user not a member of specified project
Results from all public projects only
Project status is open or published
Results from specific public project being queried and all other public projects (authentication not required)

29. PAZAR API Classes
pazar class - handles authentication and contains general methods for retrieving data and creating instance objects of other classes - a PAZAR object must always be created first. It is supplied to all methods in other classes. pazar::project - handles project information pazar::dbsource - handles information source data pazar::gene - handles gene information pazar::reg_seq - handles regulatory sequence information pazar::tf - Transcription Factor meta information and general methods for retrieving TF-related information pazar::tf::tfcomplex - handles Transcription Factor complex information pazar::tf::subunit - handles Transcription Factor subunit information pazar::tf::target - handles Transcription Factor target (regulatory sequence, artificial sequence or binding site matrix) information pazar::transcript - handles transcript information pazar::tsr - handles transcription start region information

30. PAZAR API Documentation

31. API Setup
1. Install perl library SOAP::Lite v 0.60a by Paul Kulchenko .
Later versions of SOAP::Lite maintained by different author and not compatible with the PAZAR API.
Can be downloaded from link in the PAZAR API user guide at
Also available for download from CPAN at
SOAP::Lite installation should follow standard procedures
2. Include the following at the top of your script, before any code that makes use of the API
use SOAP::Lite +autodispatch =>
uri => '
proxy => '
Any code that follows will automatically make use of PAZAR API modules via SOAP; no additional modules need to be installed on the client side.
API0.01 may be replaced by a newer release number when available (eg. API0.02), to use the newer API
Older API releases will continue to be in service after newer releases have been made available

32. Sample Perl Code Using PAZAR API
#!/usr/bin/perl
use SOAP::Lite +autodispatch =>
uri => '
proxy => '
# change and yourpass to values for your own PAZAR account
my $pazar = new -pazar_pass=>'yourpass');
my $proj = pazar::project::get_by_name(‘Demo',$pazar);
print $proj -> status ."\n";
print $proj -> id ."\n";
print $proj -> project_name ."\n";
print $proj -> description ."\n";
my $project_name = $proj -> project_name;
my $project_num=$proj->id;
= $pazar->get_all_complex_ids($project_num);
print "num tf complexes:
Setup

33. Future PAZAR API Development
API testing with other programming languages such as Java and Python
Expansion of variety of classes and methods offered
Further support for ChIP-Seq data handling
Update and import of data

34. Recap Browsing through current data online Web interface
Data Files Available for download
TF- target Gene list
ChIP-Seq peak files
GFF
XML (all data)
Bulk retrieval of most current data in customized way through programmatic approach
PAZAR API

35. Q&A
Please take a moment to type PAZAR-related questions/comments into the Chat box.
The questions will be answered shortly.