2. 1st Quiz, Name, date 1 Pick one of the following two: –A)What are some ecological roles played by native diseases? –B)What are the elements of the disease triangle? 2 Pick one of the following two: –A) In the Gilbert review, several categories of forest diseases are described: can you name and briefly describe three? –B)- Pick one category of forest diseases and write a paragraph about it

3. Summary of 1 st class Emergent diseases different from native diseases Disease triangle DNA information useful to track microbes

4. “Roles of native diseases”: Thin natural populations of treesThin natural populations of trees Optimal allocation of resourcesOptimal allocation of resources Selection for a genetically diverse host populationSelection for a genetically diverse host population Maintain tree rangesMaintain tree ranges Succession: nutrient cyclingSuccession: nutrient cycling

5. “Emergent diseases”: diseases on the rise New introduced, exotic, organismsNew introduced, exotic, organisms Good gone bad: e.g. climate change or human activities trigger excessive pathogenicity of native organismGood gone bad: e.g. climate change or human activities trigger excessive pathogenicity of native organism

6. DISEASE TRIANGLE Pathogen Host Environment

7. “Emergent diseases”: 1: host New host-pathogen combinations:New host-pathogen combinations: exotic hosts hosts planted off site

8. Cypress canker by Seiridium cardinale Pathogen was first described in California in the 20s. Later it was described in Italy where it started a serous epidemic of Italian cypress Belief that pathogen is native to California: is that true and why is it then causing a significant disease in our state?

9. Conidia of Seiridium cardinale observed by optical microscope and SEM

10. Use of molecular genetics to resolve issue of origin of pathogen Use of molecular genetics to resolve issue of origin of pathogen Used a technique similar to the one used in human forensics Native populations should comprise many different individuals genetically Introduced populations should be genetically simpler because of bottleneck related to introduction events

11. RESULTS: CA vs. Europe oCalifornia population diverse genetically= native to the state oEuropean population show no diversity=introduced

12. Symptoms caused by Seiridium cardinale on Cupressus macrocarpa (above) and xCupressocyparis leylandii (right) Fig. 3

13. Spread of the disease. Seiridium cardinale, a pandemic in progress…

14. 99.3 61.5 73.9 70.2 98.6 66.5 66.1 66.3 65.5 100 66.5 60.8 IT=Italy GR=Greece NZ=New Zealand US=USA CH=Chile Seiridium NJ tree

15. 22 1-B 6-B 5-B 4-B 3-A 2-B 8-A 9-na 15-A 11-B 16-B 19-B 14-A 12-A 10-na 21-B 17-A 18-B 20-A/B 30 29 26 39 43 35 32 33 41 37 44 24 23 7 38 45 25 28 31 36 34 40 42 27 30 46 13 Node scaling Small: singleton MGs Medium: 2-5 indivs with same MG Large: 30 indivs with same MG Dark blue = Italy only Mid blue = Italy and other MED country Light blue = Only MED country, excluding Italy Black = Morocco Red = California A = clade A in NJ tree B = clade B in NJ tree na = no sequence available Seiridium cardinale – Minimum spanning network

16. Populations 1 = Greece 2 = Italy 3 = Cal Theta1 = 0.08826 Theta2 = 0.09727 Theta3 = 0.09735 M2-->1 = 347.450 M3-->1 = 6.392 M1-->2 = 23.160 M3-->2 = 6.886 M1-->3 = 5.142 M2-->3 = 6.180 Results of coalescent analysis using MIGRATE-N

18. Why a disease in CA? If pathogen is native to California, why is it causing such a serious disease? We observed that disease incidence is variable with: –cypress species, –location,

19. Range of susceptibility Leyland cypress, Italian, monterey are listed as most susceptible Arizona and McKnob are regarded as more resistant

20. Range of susceptibility 90% of Leyland are heavily infected 10% of monterey LEYLAND CYPRESS IS AN ORNAMENTAL CROSS, NOT NATIVE

21. Range of susceptibility Monterey is more susceptible in inland areas where it is NOT NATIVE: we believe that colder temperatures cause more wounds that lead to infection

22. CONCLUSIONS Cypress canker is a serious disease in Europe because pathogen was introduced Cypress canker is a serious disease in California because hosts were introduced either through planting off range (Monterey cypress) or because host is artificial creation (Leyland cypress); extinction of LEYLAND is most likely

23. “Emergent diseases”: 2: environmental changes Forestry and intensive forest use:Forestry and intensive forest use: timber production tree felling and creation of stumps fire exclusion and increase in density oversimplified forest composition changes in forest composition changes in forest structure

24. Heterobasidion root disease Heterobasidion (a bracket or shelf mushroom) infects trees through wounds and stumps, then it spreads through the roots to neighboring trees With tree felling,stumps and wounds are created, suddenly exponentially increasing infection levels

25. Heterobasidion shelf fruit-body

28. Use of molecular genetics Use of molecular genetics: Differentiate Heterobasidion on fir/sequoias (H. occidentalis) from that on pine/junipers (H.irregularis) Show that airborne meiospores are responsible for most infection of Heterobasidion Show that in pines most infections start on stumps and that in true firs most infections on wounds

29. True firs Pines Each spore is a genetically different individual: In pines we found the same genetic individual in stumps and adjacent trees indicating direct contagion between the two In true firs and true firs/sequoias we find same individual in adjacent standing trees indicating infection not linked to stumps but to wounds on standing trees

30. CONCLUSIONS: Logging activities increase Heterobasidion infection because of stump creation in pines and because of wounding in true firs sequoias We have shown that in pine stumps H. irregularis and H. occidentalis can both be present and create a new hybrid entity We have shown that in the past these hybridization events have lead to sharing of genes among these two species (Horizontal gene transfers)

31. Armillaria root diseases Armillaria, the honey mushroom, normally infects the roots of trees. It can be a saprobe and a pathogen and is common amongst oaks If woodland composition shifts to pine/oak, pines become the target of attacks and gaps in canopy enlarge over time. Stress (e.g. flooding) exacerbates susceptibility

32. Clusters of Armillaria

33. How Does it Infect? SOURCE: http://www.forestpathology.org/dis_arm.htm l Two means of dispersal to other trees: 1.Mycelium can grow through direct root contacts and grafts with uninfected trees. 2.Rhizomorphs can grow through soil to contact uninfected trees. DEAD OAK OAK or PINE

34. What are Rhizomorphs? …“conglomerations of differentiated parallel hyphae with a protective melanized black rind on the outside.” Rhizomorphs are able to transport food and nutrients long distances which allows the fungus to grow through nutrient poor areas located between large food sources such as stumps. SOURCE: http://www.nifg.org.uk/armillaria.htm SOURCE: http://botit.botany.wisc.edu/toms_fungi/apr2002.html

35. Humongous Fungus It’s One of U-HAUL’s “Bizarre Roadside Attractions” http://botit.botany.wisc.edu/toms_fungi/apr2002.html

36. CONCLUSIONS Human activities shifting from oak woodlands to mixed oak-pine lead to large mortality gaps in pines around oaks if honey mushroom is present CHANGING SPECIES COMPOSITION LEADS TO SEVERE DISEASE

37. Many gaps with very little regeneration and have not closed in

38. Change in gap area 1972- 1999

39. “Emergent diseases”: 3: exotic pathogens 99% of times human responsible for their introduction99% of times human responsible for their introduction

40. Like the conquistadores brought diseases that were lethal to those who had never been exposed to them, so do exotic diseases cause true devastation in plant communities because of lack of coevolution between hosts and microbes

41. California invaded: 1849 A.D. New hybrid root pathogen 1990s White pine blister rust 1930s Port Orford Cedar Root Disease 1950s Pitch canker disease 1980s Dutch Elm Disease 1960s Sudden Oak Death 1990s Oak root canker 2000 Manzanita/madrone die-back Canker-stain of Sycamores 1980’s

42. How can people transport pathogens By transporting plants and plant parts –Crops, and seeds –Raw food –Ornamental plants Untreated lumber Soil Insects vectoring fungi Military activity

43. The Irish Potato Famine From 1845 to 1850 Phytophthora infestans Resulted in the death of 750,000 Emigration of over 2 million, mainly to the United States.

44. What favors invasion of exotic fungi ? –Density of host increases severity of disease –Corridors linking natural habitats –Synchronicity between host susceptibility and pathogen life cycle –Ecological and environmental conditions

46. Girdling aerial ‘cankers’ removed from roots

47. Big Sur 2006 K. Frangioso

48. P. ramorum present P. ramorum absent Wickland et al., unpublished

49. P. ramorum growing in a Petri dish

50. Organism new to science Origin unknown Biology unknown Symptoms caused unknown Immediately though highly regulated

51. Stem canker Leaf necrosis Rhododendron: In EU mostly a nursery issue, but also present in nurseries in US and Canada

52. Phytophthora ramorum Sporangia Chlamydospores

53. Is it exotic? Our studies have indicated that California population is extremely simplified, basically two strains reproducing clonally as expected of an introduced organism Many hosts appear to have no resistance at all Limited geographic distribution

54. Where does it come from? It is unknown where pathogen originally comes from, but previous studies have shown that California forest population is derived from a relatively genetically diversified US nursery population, indicating ornamental nurseries were the most likely avenue for pathogen introduction

55. Let’s look at its genetic structure Need a number of independent and neutral DNA markers Used AFLP, a technique that scans the entire nuclear genome Are our isolates the same as the European ones? Is the genetic structure suggestive of an introduced or native species?

56. US forest isolates clearly distinct from EU nursery isolates, also have different mating type Isolates from nurseries in WA, OR, & BC both of the US and EU types Potential for XXX sex and recombination in US nurseries US forest population is genetically very homogeneous, trademark of an introduced species

57. The entire genome was sequenced in less than 3 years since discovery of organism * 12 SSR loci (di- and tri- repeats identified) * Loci selected to be polymorphic both between and within continental populations * 500+ representative isolates analyzed CCGAAATCGGACCTTGAGTGCGG AGAGAGAGAGAGA CTGTACGAGCCCGAGTCTCGCAT

58. Mating Type A1 A2 Growth Rate Fast Slow Fast

59. Terminology Genotype Lineage Population

60. Results of 1st microsatellite study There actually three distinct (genotypically and phenotypically) lineages of P. ramorum Very low diversity in US forests (microsats cannot discriminate among individuals, clonality confirmed), only one lineage Several genotypes but only one lineage in EU nurseries Three lineages in US nurseries

61. Was the pathogen first in US forests or in US nurseries? Slide 12

62. Was the pathogen first in US forests or in US nurseries? Slide 12 nurserie s forests

63. Where was it introduced? First reports mid 90’s Pathogen identified in 2000 By then, the pathogen was widespread CLUES: severity of symptoms and anedoctal stories Positive isolation P. ramorum

64. We found same genotypes in nurseries and forests proving origin of wild outbreak

65. nurseries Introduction phase 1- Escape of pathogen from Infected nursery plants at two locations: Mount Tamalpais (Marin County), and Scott’s Valley (Santa Cruz County) 2- Nurseries and two sites have identical strain composition, but distance between sites is impossible for natural spread of organism

66. What favors invasion of exotic fungi ? –Density of host increases severity of disease –Corridors linking natural habitats –Synchronicity between host susceptibility and pathogen life cycle –Ecological and environmental conditions

67. Bay/Oak association Bleeding canker Canker margin in phloem Bay Coast Live Oak (no sporulation) Sporangia

69. Mantel test among all individuals. [Moran ’ s I vs ln (geographic distance)] Site ID Correlation coeff. (r) P-value (1000,000 perm) ALL -0.2153<0.000001

70. Synchrony pathogen-host Susceptibility of oaks (lesion size)

71. Wetness > 12 h Temp >19 C

72. Bay Laurel / Tanoak SOD Spore Survey Date Temp (C) Rain (mm)

73. How to control emergent exotic diseases PREVENT THEIR INTRODUCTION LIMIT THE HUMAN-SPREAD OF PATHOGENS (infected plants, plant parts, dirty tools) EMPLOY HOST RESISTANCE CHEMICAL AND OTHER MITIGATION STRATEGIES

74. Forest pathogens can never be eradicated

76. PREVENT: Diagnose Symptoms relatively generic, very variable, and pathogen not always culturable LAB CULTURES DNA TESTS

78. AgriFos and PentraBark Topical Application +

79. Agrifos vs. Azomite Treatments (efficacy 1 - 24 months) Canker Size (mm) a a b

80. Why emphasis on molecular analyses? As a way to identify and quantify microbes in the environment As a way to understand microbial biology: how do microbes reproduce and infect hosts As a way to determine epidemiology: follow the movement of a strain

81. Why emphasis on molecular analyses? As a way to determine potential for spread: use genes as markers for individuals As a way to determine whether population of microbes is exotic or native As a way to identify source of a pathogen and migration patterns

82. Why emphasis on molecular analyses? As a way to determine the size of the gene pool of a pathogen, Important to scale management options As a way to determine rapid evolutionary changes linked to an introduction As a way to determine epigenetic effects