1. Mutation Analysis using Temperature Gradient Gel Electrophoresis

2. Overview 1. Introduction 2. Basic principle of TGGE 3. Applications 4. Optimizing new assays 5. Versatility of TGGE systems

3. Introduction  TGGE is a type of acrylamide gel electrophoresis which is used to detect point mutations and polymorphisms within PCR-products.  TGGE is very fast and sensitive in detecting heterozygous sequence variations within the PCR- product. These qualities make TGGE the screening method of choice

4. Conventional Electrophoresis  Conventional electrophoresis techniques separate biomolecules by their size, charge or isoelectric point. Separation by Separates Electrophoresis Type Application SizeDNA/RNAHorizontal, Vertical Agarose gel Molecular weight ProteinsVertical SDS-Page Isoelectric point ProteinsHorizontal, Vertical Isoelectric focussing Sizess DNAVertical Sequencing gel

5. Principle of Temperature Gradient Gel Electrophoresis  Conventional protein or nucleic acid electrophoresis separates molecules according to their size or charge.  TGGE separates molecules by their melting behavior.

6.  TGGE separate samples either parallel or perpendicular to a temperature gradient.  A: temperature gradient from left to right.  B: temperature gradient from top to bottom.

7. Application of TGGE Two major filed of application for TGGE:  Mutation Analysis in PCR Fragment.  Diversity Analysis of Complex Bacterial samples.

8. Establishing TGGE protocols TGGE protocols …  Design of PCR fragment.  In silico optimization  Finding the optimal temperature gradient  Transfer from perpendicular to parallel TGGE for routine analyses

9. Design of PCR fragment  PCR primers should be designed with a conventional computer program.  The melting behavior of the resulting fragment should then be checked with the.  The melting behavior of the resulting fragment should then be checked with the Poland software.  It is essential that the DNA fragment shows different melting domains.  If there is only one single melting domain, an artificial higher melting domain (called GC clamp) must be added during PCR. Gene fragment of interest

10. In silico optimization  Computer analysis can be done prior to starting electrophoresis.  The Poland software calculates the melting behavior of a DNA fragment according to its base sequence.  The ideal fragment shows at least two distinct melting domains, mutation can only be detected in the lower melting domain. Poland analysis

11. TGGE flow chart of success  Step I  Step II  Step III (http://www.biophys.uni-duesseldorf.de/POLAND/poland.html). CGGGCGGGGGCGGCGGGCCGGGCGCGGGGCGCGGCGGGCGACATCT GGACCCAACTCCTG

12.  Tm plot of a 140bp DNA fragment resulting from Poland analysis. The second order curve (red color in the original) shows two different melting domains.  If the fragment consists of a single melting domain only then GC clamp to one end of the PCR fragment should be added.

13. GC clamps  GC clamp is an artificial, high melting domain which is attached to one end of the fragment during PCR. GC clamp  The name “GC clamp” implies that this short stretch will hold the DNA fragment together, Prevent dissociation into the single strands at higher temperatures

14. To integrate a GC clamp into a PCR fragment, one of the two primers has to be modified… The non-specific GC sequence is added to the 5´-end of the primer. Thus the GC sequence is incorporated in the fragment during PCR. cccgc cgcgc cccgc cgccc gccShort GC-clamp (23) bp cgccc gccgc gcccc gcgcc cggcc cgccg ccccc gcccg Long GC-clamp (40 bp)44 ccccg ccccc gccgc ccccc ccgcg cccgg cgccc ccgc Long GC-camp (39 bp)45

15. Find correct temperature gradient perpendicular TGGE  To identify the optimum temperature gradient the DNA fragment is separated in a perpendicular TGGE.  This means the temperature gradient is perpendicular to the migration of samples.

16.  At T1 the double strand starts to melt and forms a branched structure.  At T2 the partial double strand separates irreversibly into the single strands.  Analysis of samples in parallel TGGE should be performed precisely in this temperature range between T1 and T2.

17. How to identify the optimum temperature range from a perpendicular gel  There is a linear temperature gradient between L0 and L10 (i.e. the temperature increment from one line to next line is always the same).  Place the stained gel on the plastic film with the printed lines (L0 to L10).  Identify the line where the double strand starts to melt (T1) and the line where the double strands separates into the single strands (T2).

18. Perpendicular TGGE - Finding the optimum gradient  One sample is separated over a gradient that is perpendicular to the electrophoresis.

19. Parallel analysis of multiple samples  After identification of T1 and T2 in a perpendicular TGGE this temperature gradient is spread over the whole block for parallel analysis. Notes:  The DNA fragments are separated by their melting behavior. They can be distinguished as soon as the fragments begin to melt, i.e. they form a fork like structure.  During electrophoresis the fragments should not separate into single strands.  This is an irreversible transition resulting in diffuse bands.

20. Calculation Example: calculation of temperature at line 6 (L6) in a temperature gradient from 40°C (L0) to 60°C (L10)  Subtract temperature at L0 from temperature L10 (range of gradient: 60-40°C = 20°C).  Divide temperature by 10 (increment from line to lane: 20°C/10 = 2°C).  Multiply increment by 6 (6 increments from L0 to L6: 12°C).  Add this value to the temperature at L0 (40°C + 12°C). Result: temperature at L6 is 52°C

21. Transfer from perpendicular to parallel TGGE  Perpendicular for establishing  Parallel for routine analysis

22. Tips from the bench  In contrast to conventional electrophoresis, in TGGE the migration length does NOT only depend on running time, but rather on the temperature gradient. Extended running times do not necessarily lead to a better separation of bands Instead, the temperature gradient should be optimized … !

23. Advantages of TGGE  Mixed DNA fragments of same size can be separated in a gel.  Identification and differentiation of allelotypes

24. Versatility of TGGE systems  TGGE systems could be also used for :  DGGE (Denaturing Gradient Gel Electrophoresis)  CDGE (Constant Denaturing Gel Electrophoresis)  SSCP (Single Strand Conformation Polymorphism)

25. Versatility of TGGE systems  DNA based TGGE applications :  Mutation analyses  Heteroduplex analyses (HA)  Imprinting studies (= DNA methylation)  Differentiation of amplicon and competitor for quantitative DNA analyses

26. Versatility of TGGE systems  RNA based TGGE application :  Secondary structure analysis of RNA  Analysis of dsRNA molecules  Protein based TGGE applications :  Thermal stability analysis of proteins  Protein/protein or protein/ligand interaction analysis

27. TGGE Systems TGGE System TGGE Maxi System Small separation distance  Small separation distance  Short running times  Long separation distance  Ideal for complex mixtures  High parallel sample throughput

28. The TGGE system System overview The TGGE system consists of three components: 1) Electrophoresis unit : including thermoblock, buffer chambers, safety lid. 2) Controller: control of electrophoresis parameters (Voltage) and temperature gradient. 3) Power supply : power supply for electrophoresis unit and controller.

29. Assembly of the gel cuvette Glass plates for casting parallel (left) or perpendicular gels (right).

30. Preparing gel solution  The choice of the buffer system has a strong impact on TGGE analysis.  Concentration of salt and denaturing agents (urea) strongly affects the melting temperature of DNA and proteins.  The most popular buffer systems for TGGE are TBE, TAE and MOPS.

31. Preparing gel solution for TBE buffer system for 100 mlstock solutionGel composition final concentrations 20ml40 % (37,5 :1)Acrylamid [8%] 42 gsolidurea [7M] 10 ml1 xTBE [0.1x] 5 ml40%Glycerol [2%] To 100ml Adjust with water Continue... 1. Stir solution at 50°C until urea is completely dissolved. 2. Carefully degas gel solution 3. let cool down to room temperature and start polymerization with …

32. for 100 mlstock solutionGel composition final concentrations 160 µl10%APS 220 µl100%TEMED 4. Load gel solution in a syringe …… 5. Pour gel through sterile filter into the glass sandwich. Pouring gels 1)Pour gel solution slowly into the sandwich. Avoid bubbles! 2) Let polymerize for approx. 3 h at room temperature

33. Setup of glass plate sandwich

34. Assembly of glass plate and sealing

35. Final setup of the gel cuvette Note: the clamps should be placed directly on the spacers.

36. Staining  Silver staining: the most sensitive method for detecting small amounts of DNA, RNA or proteins in polyacrylamid gels.  Ethidium bromide-staining: Incubate the gel in staining solution (0.5 g/ml ethidium bromide in 1 X TBE) for 30 - 45 min. Analyze under UV radiation