2. GENETIC MARKERS IN PLANT BREEDING

3. Use Clonal identity Parental analysis Family structure Population structure Population structure Gene flow Phylogeography Hybridisation Phylogeny SCALE

4. MARKERS IN BIOLOGY 1. Phenotypic markers = Naked eye markers P = E+G Flower colors, shape of pods, etc..

5. Karl Von Linne (1707-1778)

6. Readily detectable sequence of protein or DNA whose inheritance can be monitored and associated with the trait inheritance independently from the environment: a) protein polymorphisms b) DNA polymorphisms 2. Genotypic (molecular) markers

7. Molecular markers Resolutionpower Resolution power allozymes (protein-electrophoresis) chloroplastDNA PCR-RFLP RAPD (random amplified polymorphic DNA) AFLP (Amplified Fragment Length Polymorphism) Multi-locus fingerprints Microsatellites (SSRs) Sequencing (SNPs)

8. Seed storage proteins Isozymes Proteins Polymorphisms

9. Isozyme

10. Starch gel of the isozyme malate dehydrogenase (MDH). The numbers indicate first the MDH locus, and next the allele present (ie. 3-18 is locus 3 allele 18). Some bands are heterodimers (intralocus or interlocus). Isozyme

11. Chromosome to DNA DNA structure 1 ccacgcgtcc gtgaggactt gcaagcgccg cggatggtgg gctctgtggc tgggaacatg 61 ctgctgcgag ccgcttggag gcgggcgtcg ttggcggcta cctccttggc cctgggaagg 121 tcctcggtgc ccacccgggg actgcgcctg cgcgtgtaga tcatggcccc cattcgcctg 181 ttcactcaga ggcagaggca gtgctgcgac ctctctacat ggacgtacag gccaccactc 241 ctctggatcc cagagtgctt gatgccatgc tcccatacct tgtcaactac tatgggaacc 301 ctcattctcg gactcatgca tatggctggg agagcgaggc agccatggaa cgtgctcgcc 361 agcaagtagc atctctgatt ggagctgatc ctcgggagat cattttcact agtggagcta 421 ctgagtccaa caacatagca attaaggtag gaggagggat ggggatgttg tgtggccgac 481 agttgtgagg ggttgtggga agatggaagc cagaagcaaa aaagagggaa cctgacacta 541 tttctggctt cttgggttta gcgattagtg cccctctctc atttgaactc aactacccat 601 gtctccctag ttctttctct gcctttaaaa aaaaatgtgt ggaggacagc tttgtggagt 661 ctgaaatcac catctacctt tacttaggtt ctgagtgcca aacccaaggc accaggcatg 721 cgtccttgac tccggagcca tcaggcaggc tttcctcagc cttttgcagc caagtctttt 781 agcctattgg tctgagttca gtgtggcagt tggttaggaa agaaggtggt tcttcgacca 841 ctaacagttt ggatttttta ggatgctagt cctttaaaa ………. Stretch of nitrogen fixation gene in soybean

12. DNA Gene A Gene B AACCTGAAAAGTTACCCTTTAAAGGCTTAAGGAA AAAGGGTTTAACCAAGGAATTCCATCGGGAATTCCG MFG 1 ccacgcgtcc gtgaggactt gcaagcgccg cggatggtgg gctctgtggc tgggaacatg 61 ctgctgcgag ccgcttggag gcgggcgtcg ttggcggcta cctccttggc cctgggaagg 121 tcctcggtgc ccacccgggg actgcgcctg cgcgtgtaga tcatggcccc cattcgcctg 181 ttcactcaga ggcagaggca gtgctgcgac ctctctacat ggacgtacag gccaccactc 241 ctctggatcc cagagtgctt gatgccatgc tcccatacct tgtcaactac tatgggaacc 301 ctcattctcg gactcatgca tatggctggg agagcgaggc agccatggaa cgtgctcgcc 361 agcaagtagc atctctgatt ggagctgatc ctcgggagat cattttcact agtggagcta 421 ctgagtccaa caacatagca attaaggtag gaggagggat ggggatgttg tgtggccgac 481 agttgtgagg ggttgtggga agatggaagc cagaagcaaa aaagagggaa cctgacacta 541 tttctggctt cttgggttta gcgattagtg cccctctctc atttgaactc aactacccat 601 gtctccctag ttctttctct gcctttaaaa aaaaatgtgt ggaggacagc tttgtggag MFG molecular marker? M1M1 M2M2 readily detectable sequence of DNA whose inheritance can be monitored and associated with the trait inheritance

13. Image from UV light table Image from computer screen

14. Polymorphism -Parent 1 : one band -Parent 2 : a smaller band -Offspring 1 : heterozygote = both bands -Offspring 2 : homozygote parent 1 Polymorphism Parent 1 : one band -Parent 2 : no band -Offspring 1 : homozygote parent 1 -Offspring 2 : ???? P 2 P 1 O 2 O 1 Gel configuration Co-dominant marker P 2 Gel configuration P 1 O 1 O 2 Dominant marker

15. Dominant versus Co-dominant Dominant: No distinction between homo- and heterozygotes possible No allele frequencies available AFLP, RAPD Co-dominant: homozygotes can be distinguished from heterozygotes; allele frequencies can be calculated microsatellites, SNP, RFLPs

16. * Polymorphic * Occurs throughout the genome * Co-dominant inheritance * Easy, fast and cheap to detect * Reproducible Desirable properties for a good molecular marker * Selectivity neutral * High resolution with large number of samples

17. Basis for DNA marker technology Restriction Endonucleases DNA-DNA hybridization Polymerase chain reaction (PCR ) DNA sequencing

18. RFLP based markers * Examine differences in size of specific DNA restriction fragments * Usually performed on total cellular genome * Require pure, high molecular weight DNA

19. Endonucleases and restriction sequences AAATCGGGACCTAATGGGCC ATTTAGGGCAATTCCAAGGA YFG Ind 1Ind 2

20. RFLP techniques

21. 362 6 12435 45 1 MFG RFLP Polymorphisms interpretation

22. Advantages and disadvantages of RFLP Advantages –Reproducible –Co-dominant –Simple Disadvantages –Time consuming –Expensive –Use of radioactive probes

23. DNA/DNA Hybridization Denaturation Elevated temperature Known DNA sequence

24. Polymerase Chain Reaction Powerful technique for amplifying DNA Amplified DNA are then separated by gel electrophoresis

25. PCR based methods 1. Reactions conditions * Target DNA ( or template) * Reaction buffer containing the co-factor MgCl 2 * One or more primers * Thermostable DNA polymerase * Four nucleotides (dATP, dCTP, dGTP, dTTP)

26. 2. Use of DNA polymerase = an enzyme that can synthesize DNA at elevated temperature ex : Taq = enzyme purified from hot spring bacterium : Thermus aquaticus 3. Thermal cycle * Denaturing step - one to several min at 94-96 º C * Annealing step - one to several min at 50-65 º C * Elongation step - one to several min at 72 º C 4. Repetition –typically 20 to 50 times average 35 times

27. AFLP Markers Most complex of marker technologies Most complex of marker technologies Involves cleavage of DNA with two different enzymes Involves cleavage of DNA with two different enzymes Involves ligation of specific linker pairs to the digested DNA Involves ligation of specific linker pairs to the digested DNA Subsets of the DNA are then amplified by PCR Subsets of the DNA are then amplified by PCR

28. AFLP Markers The PCR products are then separated on acrylamide gel The PCR products are then separated on acrylamide gel 128 linker combinations are readily available 128 linker combinations are readily available Therefore 128 subsets can be amplified Therefore 128 subsets can be amplified Patented technology Patented technology

32. AFLP Markers Technically demanding Technically demanding Reliable and stable Reliable and stable Moderate cost Moderate cost Need to use different kits adapted to the size of the genome being analyzed. Need to use different kits adapted to the size of the genome being analyzed. Like RAPD markers need to be converted to quick and easy PCR based marker Like RAPD markers need to be converted to quick and easy PCR based marker

33. RAPD Markers There are other problems with RAPD markers associated with reliability There are other problems with RAPD markers associated with reliability Because small changes in any variable can change the result, they are unstable as markers Because small changes in any variable can change the result, they are unstable as markers RAPD markers need to be converted to stable PCR markers. RAPD markers need to be converted to stable PCR markers. How? How?

34. RAPD Markers The polymorphic RAPD marker band is isolated from the gel The polymorphic RAPD marker band is isolated from the gel It is used a template and re-PCRed It is used a template and re-PCRed The new PCR product is cloned and sequenced The new PCR product is cloned and sequenced Once the sequence is determined, new longer and specific primers can be designed Once the sequence is determined, new longer and specific primers can be designed

35. RAPD Domimant markers Reproducibility problems Amplifies anonymous stretches of DNA using arbitrary primers Fast and easy method for detecting polymorphisms

36. RAPD Polymorphisms among landraces of sorghum M Sequences of 10-mer RAPD primers NameSequence OP A085’ –GTGACGTAGG- 3’ OP A155’ –TTCCGAACCC- 3’ OP A 175’ –GACCGCTTGT- 3’ OP A195’ –CAAACGTCGG- 3’ OP D025’ –GGACCCAACC- 3’ RAPD gel configuration

37. Sequence GCGCCGAGTTCTAGGGTTTCGGAATTTGAACCGTC ATTGGGCGTCGGTGAAGAAGTCGCTTCCGTCGTTTGAT TCCGGTCGTCAGAATCAGAATCAGAATCGATATGGTG GCAGTGGTGGTGGTGGTGGTGGTTTTGGTGGTGGTGA ATCTAAGGCGGATGGAGTGGATAATTGGGCGGTTGGT AAGAAACCTCTTCCTGTTAG ATTCTGGAATGGAACCAGATCGCTGGTCTAGAGGTTCT GCTGTGGAACCA….. Repeat GGT(5) SSR repeats and primers GAGGGCTGATGAGGTGGATA ATCTTATGGCGGTTCTCGTG

38. AATCCGGACTAGCTTCTTCTTCTTCTTCTTTAGCGAATTAGG P1P1 AAGGTTATTTCTTCTTCTTCTTCTTCTTCTTCTTAGGCTAGGCG P2P2 P1P1 P2P2 SSR polymorphisms Gel configuration

39. Linkage groups

40. M SSR scoring for F 5:6 pop from the cross Anand x N97-3708-13 Anand N97

41. 4. SNPs (Single Nucleotide Polymorphisms) Any two unrelated individuals differ by one base pair every 1,000 or so, referred to as SNPs. Many SNPs have no effect on cell function and therefore can be used as molecular markers. Hybridization using fluorescent dyes SNPs on a DNA strand

42. DNA sequencing Sequencing gel Sequencer Sequencing graph

43. Single gene trait: seed shapeMultigenic trait; ex: plant growth =Quantitative Trait Loci Types of traits =types of markers MFG

44. USES OF MOLECULAR MARKER  Measure genetic diversity  Mapping  Tagging

45. Genetic Diversity  Define appropriate geographical scales for monitoring and management (epidemology)  Establish gene flow mechanism  identify the origin of individual (mutation detection)  Monitor the effect of management practices  manage small number of individual in ex situ collection  Establish of identity in cultivar and clones (fingerprint)  paternity analysis and forensic

46. Genetic Diversity

47. early selection of the good allele seeds, plantlets fingerprints Gotcha!

48. Mapping  The determination of the position and relative distances of gene on chromosome by means of their linkage  Genetic map A linear arrangement of genes or genetic markers obtained based on recombination  Physical map A linear order of genes or DNA fragments

49. Physical Mapping  It contains ordered overlapping cloned DNA fragment  The cloned DNA fragments are usually obtained using restriction enzyme digestion

50. QTL Mapping  A set of procedures for detecting genes controlling quantitative traits (QTL) and estimating their genetics effects and location  To assist selection

51. Marker Assisted Selection Breeding for specific traits in plants and animals is expensive and time consuming Breeding for specific traits in plants and animals is expensive and time consuming The progeny often need to reach maturity before a determination of the success of the cross can be made The progeny often need to reach maturity before a determination of the success of the cross can be made The greater the complexity of the trait, the more time and effort needed to achieve a desirable result. The greater the complexity of the trait, the more time and effort needed to achieve a desirable result.

52. MAS The goal to MAS is to reduce the time needed to determine if the progeny have trait The goal to MAS is to reduce the time needed to determine if the progeny have trait The second goal is to reduce costs associated with screening for traits The second goal is to reduce costs associated with screening for traits If you can detect the distinguishing trait at the DNA level you can identify positive selection very early. If you can detect the distinguishing trait at the DNA level you can identify positive selection very early.

53. Developing a Marker Best marker is DNA sequence responsible for phenotype i.e. gene Best marker is DNA sequence responsible for phenotype i.e. gene If you know the gene responsible and has been isolated, compare sequence of wild-type and mutant DNA If you know the gene responsible and has been isolated, compare sequence of wild-type and mutant DNA Develop specific primers to gene that will distinguish the two forms Develop specific primers to gene that will distinguish the two forms

54. Developing a Marker If gene is unknown, screen contrasting populations If gene is unknown, screen contrasting populations Use populations rather than individuals Use populations rather than individuals Need to “blend” genetic differences between individual other than trait of interest Need to “blend” genetic differences between individual other than trait of interest

55. Developing Markers Cross individual differing in trait you wish to develop a marker Cross individual differing in trait you wish to develop a marker Collect progeny and self or polycross the progeny Collect progeny and self or polycross the progeny Collect and select the F2 generation for the trait you are interested in Collect and select the F2 generation for the trait you are interested in Select 5 - 10 individuals in the F2 showing each trait Select 5 - 10 individuals in the F2 showing each trait

56. Developing Markers Extract DNA from selected F2s Extract DNA from selected F2s Pool equal amounts of DNA from each individual into two samples - one for each trait Pool equal amounts of DNA from each individual into two samples - one for each trait Screen pooled or “bulked” DNA with what method of marker method you wish to use Screen pooled or “bulked” DNA with what method of marker method you wish to use Method is called “Bulked Segregant Analysis” Method is called “Bulked Segregant Analysis”

57. Marker Development Other methods to develop population for markers exist but are more expensive and slower to develop Other methods to develop population for markers exist but are more expensive and slower to develop Near Isogenic Lines, Recombinant Inbreeds, Single Seed Decent Near Isogenic Lines, Recombinant Inbreeds, Single Seed Decent What is the advantage to markers in breeding? What is the advantage to markers in breeding?

58. Reducing Costs via MAS Example disease resistance Example disease resistance 10000 plants10000 plants Greenhouse space or field plots Greenhouse space or field plots $5000 - $10000$5000 - $10000 Time 4 months (salary) Time 4 months (salary) $10 - $15000$10 - $15000 total cost = $15 - $25,000total cost = $15 - $25,000

59. Reducing Costs via MAS PCR-based testing @ $5 sample PCR-based testing @ $5 sample $50,000 - costs more? $50,000 - costs more? Analysis of trait not easily phenotyped Analysis of trait not easily phenotyped E.g: Cadmium in Durum wheat E.g: Cadmium in Durum wheat 10000 plants need to reach maturity 10000 plants need to reach maturity Cadmium accumulates in seed Cadmium accumulates in seed

60. Reducing costs via MAS $15 - 25 growing costs + analysis $15 - 25 growing costs + analysis Atomic Absorption @ $15 per sample Atomic Absorption @ $15 per sample $150,000 + growing costs $150,000 + growing costs PCR analysis still $50000 PCR analysis still $50000 Savings in time and money increase as more traits are analyzed Savings in time and money increase as more traits are analyzed Many biochemical tests cost >$50 sample Many biochemical tests cost >$50 sample

61. Marker Assisted Breeding MAS allows for gene pyramiding - incorporation of multiple genes for a trait MAS allows for gene pyramiding - incorporation of multiple genes for a trait Prevents development of biological resistance to a gene Prevents development of biological resistance to a gene Reduces space requirements - dispose of unwanted plants and animal early Reduces space requirements - dispose of unwanted plants and animal early

62. Trait 2.5 8.4 7.1 2.5 4.5 2.3 P.1 P.2 I.1 I.2 I.3 I.4 M. 1 133221133221 M. 2 131131131131 M. 3 131123131123 QTL study Statistical programs used in molecular marker studies * SAS * ANOVA * Mapmaker * Cartographer Types of population used for molecular markers studies: F 2, RILs, Backcrosses (MILs), DH.

63. QTL Mapping